ID: 1116761589

View in Genome Browser
Species Human (GRCh38)
Location 14:49021963-49021985
Sequence TGCCATTGCTGTCTTGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116761589_1116761596 12 Left 1116761589 14:49021963-49021985 CCGACCCCAAGACAGCAATGGCA No data
Right 1116761596 14:49021998-49022020 CTTATGGAAGACGTGCAAGCAGG No data
1116761589_1116761595 -4 Left 1116761589 14:49021963-49021985 CCGACCCCAAGACAGCAATGGCA No data
Right 1116761595 14:49021982-49022004 GGCAGCATGGGTAGTGCTTATGG No data
1116761589_1116761599 22 Left 1116761589 14:49021963-49021985 CCGACCCCAAGACAGCAATGGCA No data
Right 1116761599 14:49022008-49022030 ACGTGCAAGCAGGGCAAGTAGGG No data
1116761589_1116761600 23 Left 1116761589 14:49021963-49021985 CCGACCCCAAGACAGCAATGGCA No data
Right 1116761600 14:49022009-49022031 CGTGCAAGCAGGGCAAGTAGGGG No data
1116761589_1116761597 13 Left 1116761589 14:49021963-49021985 CCGACCCCAAGACAGCAATGGCA No data
Right 1116761597 14:49021999-49022021 TTATGGAAGACGTGCAAGCAGGG No data
1116761589_1116761598 21 Left 1116761589 14:49021963-49021985 CCGACCCCAAGACAGCAATGGCA No data
Right 1116761598 14:49022007-49022029 GACGTGCAAGCAGGGCAAGTAGG No data
1116761589_1116761601 24 Left 1116761589 14:49021963-49021985 CCGACCCCAAGACAGCAATGGCA No data
Right 1116761601 14:49022010-49022032 GTGCAAGCAGGGCAAGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116761589 Original CRISPR TGCCATTGCTGTCTTGGGGT CGG (reversed) Intergenic
No off target data available for this crispr