ID: 1116763567

View in Genome Browser
Species Human (GRCh38)
Location 14:49043989-49044011
Sequence TTTGATATAATGGCAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116763565_1116763567 20 Left 1116763565 14:49043946-49043968 CCATCTTAGTCAAAACTTCAGAG No data
Right 1116763567 14:49043989-49044011 TTTGATATAATGGCAAAGACAGG No data
1116763564_1116763567 25 Left 1116763564 14:49043941-49043963 CCAAGCCATCTTAGTCAAAACTT No data
Right 1116763567 14:49043989-49044011 TTTGATATAATGGCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116763567 Original CRISPR TTTGATATAATGGCAAAGAC AGG Intergenic
No off target data available for this crispr