ID: 1116766228

View in Genome Browser
Species Human (GRCh38)
Location 14:49073492-49073514
Sequence TCTTTGTTGATTTTCTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1276
Summary {0: 42, 1: 143, 2: 156, 3: 203, 4: 732}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116766228_1116766230 12 Left 1116766228 14:49073492-49073514 CCCAGACAGAAAATCAACAAAGA 0: 42
1: 143
2: 156
3: 203
4: 732
Right 1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116766228 Original CRISPR TCTTTGTTGATTTTCTGTCT GGG (reversed) Intergenic
900017186 1:160285-160307 TCTTTGGAGATTCTCTGTATAGG - Intergenic
900047445 1:518881-518903 TCTTTGGAGATTCTCTGTATAGG - Intergenic
900069658 1:760750-760772 TCTTTGGAGATTCTCTGTATAGG - Intergenic
900904294 1:5540936-5540958 TCTTTGTTGATTTTCAGTTTAGG + Intergenic
901799469 1:11699270-11699292 GTTTTGTTGATTTTATGTATTGG - Intronic
902422799 1:16294917-16294939 TATTTGTGTATTTTCTTTCTAGG - Exonic
903581687 1:24375785-24375807 TTTCAGTTGCTTTTCTGTCTGGG - Intronic
904572275 1:31475367-31475389 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
906326276 1:44848079-44848101 GCTTTCTAGACTTTCTGTCTGGG + Intergenic
906864558 1:49403032-49403054 CTTTTGTTGATTTTCTGTCTGGG + Intronic
906884999 1:49635072-49635094 GCTTTGCTGATTTTCTTTCAGGG - Intronic
907139962 1:52177459-52177481 TCTTTGTTGATTTTTTGTCTGGG + Intronic
907725294 1:57015089-57015111 TCTTTGCCCATTTTCTGCCTGGG + Exonic
907896302 1:58695686-58695708 TCTTTGAGTATTTTCTGTTTTGG - Intronic
908290066 1:62656825-62656847 TCTTTTTTGATCTTTTGGCTGGG - Intronic
908372601 1:63498149-63498171 TCCTTGCTGATTTTCTATCTAGG - Intronic
908517769 1:64910893-64910915 TGTTTGCTGATGTTCTGACTTGG - Intronic
909225627 1:73018132-73018154 TCTTACTAGATTTTCTGTGTTGG + Intergenic
909232819 1:73113597-73113619 TATTTGTTTATTTGCTTTCTTGG + Intergenic
909374734 1:74926510-74926532 TCTTTGTTAATTTTCTGTCTTGG - Intergenic
909420655 1:75461590-75461612 TCATTATTGAGTTACTGTCTAGG + Intronic
909521258 1:76570763-76570785 TCTTTCTTCATTTCCTTTCTTGG + Intronic
909545730 1:76844328-76844350 TCTCTCTTGATTTTCTATCCTGG + Intergenic
909772728 1:79444145-79444167 CCTTTGTAGTTTTTCTGTGTTGG - Intergenic
909830489 1:80183197-80183219 TCTTTGTTAACTTTTTGTCTTGG + Intergenic
909848578 1:80431296-80431318 TCTTTGTTGATTTTCTGTGTGGG + Intergenic
909870863 1:80736796-80736818 TCTGTGTTGATTTTCTGTCTGGG + Intergenic
909870865 1:80736823-80736845 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
909885542 1:80938375-80938397 TCTTTGATAATTTTCTCTCTAGG - Intergenic
909906530 1:81202441-81202463 TCTTTGTTTATTTTATGTCAGGG + Intergenic
910290142 1:85592472-85592494 TCTTTGTTGATTTTGTCTCTGGG - Intergenic
910422475 1:87081152-87081174 TCTTTGTGGTTTTTCTGTCTGGG - Intronic
910716150 1:90233224-90233246 TCTTTGTTGATTATCTGTCTGGG + Intergenic
911486154 1:98508010-98508032 TCTTTGTTGATTTTCTGACTAGG - Intergenic
911805972 1:102208913-102208935 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
911826187 1:102487650-102487672 TGTTTGTTTGTTTTTTGTCTGGG - Intergenic
911831836 1:102559848-102559870 TCTTTATTGATATTCTCTATTGG + Intergenic
912169386 1:107080031-107080053 TCTTTATTTTTTTTCAGTCTGGG + Intergenic
912281871 1:108324103-108324125 TCTTTATTGATATTCTGTCTGGG + Intergenic
912316699 1:108673806-108673828 TCTTTGTTGAATTTCTGTAAGGG - Intergenic
912406135 1:109439199-109439221 GTTTTGTTGATTTTCTCTCTCGG - Intergenic
912588747 1:110792128-110792150 TCTTTGTCAGTTTTCTGCCTCGG - Intergenic
912608308 1:111016133-111016155 TCTAGGTTGATTTCATGTCTTGG + Intergenic
912614891 1:111089048-111089070 TGTTTCTTTATCTTCTGTCTGGG + Intergenic
912624848 1:111198517-111198539 CATTTGTTGATTTTCGGCCTGGG - Intronic
912686278 1:111768786-111768808 TTTTTTTTGATTGTCAGTCTAGG + Intergenic
912756896 1:112331955-112331977 TCATTGTTGAGTTTCCATCTAGG + Intergenic
912783505 1:112575844-112575866 TATTTGTTGACTCTCTTTCTTGG + Intronic
912954098 1:114140505-114140527 TGTTTATTGAGTTCCTGTCTTGG - Intronic
913100851 1:115563711-115563733 TTTTTGTTAATTTTCTATCTAGG - Intergenic
913429227 1:118771382-118771404 TCTTTGTTGACATTCTGTTTTGG - Intergenic
913575604 1:120171033-120171055 TCTATGTTGATATTATTTCTTGG - Intronic
913686518 1:121237146-121237168 TCTCTGGTGATTGTCTGTATAGG + Intronic
913707230 1:121437633-121437655 TCTTTGTTCATTATCTGTCTGGG - Intergenic
913979163 1:143492974-143492996 TCTTTTTTTATTCTCTGTGTTGG + Intergenic
914038369 1:144024786-144024808 TCTCTGGTGATTGTCTGTATAGG + Intergenic
914073568 1:144318624-144318646 TCTTTTTTTATTCTCTGTGTTGG + Intergenic
914105587 1:144647736-144647758 TCTTTTTTTATTCTCTGTGTTGG - Intergenic
914151086 1:145043122-145043144 TCTCTGGTGATTGTCTGTATAGG - Intronic
914557918 1:148786603-148786625 TCTATGTTGATATTCTTTCTTGG - Intergenic
914614916 1:149343627-149343649 TCTATGTTGATATTCTTTCTTGG + Intergenic
914750594 1:150532431-150532453 TCTTTTGTGATTTTATGCCTGGG - Intergenic
915337040 1:155150342-155150364 TCTTTGTTGATTTTCTATCTGGG - Intergenic
915517213 1:156420580-156420602 TTTTTGTTGTTGTTTTGTCTCGG - Intronic
916276849 1:163003542-163003564 ACTTTGTTGATTTTTTTCCTTGG + Intergenic
916315151 1:163440495-163440517 TCTTTCTTGTTTTTCTGTTTTGG + Intergenic
916379412 1:164192546-164192568 TCTTTGCAGATTTTTTGTCTGGG - Intergenic
916999976 1:170347020-170347042 TAGCTGTTGATTTTCTGTCTCGG + Intergenic
917006823 1:170424743-170424765 TCTTTTTTGTTTTACTTTCTTGG + Intergenic
917069271 1:171131692-171131714 TCTTGCTTGATTGTCTGGCTAGG - Intergenic
917186963 1:172368066-172368088 TCTTTGTTGATTTTATGCCTAGG - Intronic
917246026 1:173001936-173001958 TTGTTATTGATTTTCTGTCTGGG + Intergenic
917274104 1:173312512-173312534 TCTTTGTCTATTTTCTCTCTTGG - Intergenic
917695067 1:177513950-177513972 TGTTTGTTGTTTACCTGTCTAGG + Intergenic
918453018 1:184678833-184678855 TCTTAGATGATTTTTTGTCATGG - Intergenic
918514398 1:185346442-185346464 TCTGAGTTGTTTTTCTGGCTGGG + Intergenic
918563419 1:185897086-185897108 TTTTTCTTCTTTTTCTGTCTTGG + Intronic
918662298 1:187104778-187104800 TCTTTGTTCTTATTTTGTCTTGG - Intergenic
918760486 1:188398352-188398374 GCTTTGTTGATTTTCTGTCTAGG - Intergenic
918986295 1:191631797-191631819 TCTTTGTTGACTTTTTGTCTAGG - Intergenic
919111532 1:193225571-193225593 TGTTTTTTGATTTTTTGACTAGG + Intronic
919239549 1:194894722-194894744 TCTTGGTTGCTTTTCTGTTTTGG - Intergenic
919358157 1:196553405-196553427 TCTTTATTGATTTTCTTTCTGGG - Intronic
919358170 1:196553580-196553602 TCTTTATTGATTTTCTTTCTGGG - Intronic
919397803 1:197072202-197072224 TTGTTGTTGACTTTCTGTCTTGG - Intergenic
919410197 1:197233128-197233150 TGTTTTTTGATTTACTATCTTGG - Intergenic
919532380 1:198739671-198739693 TCTTTGTTGATTTTCTTCCTGGG - Intronic
919595357 1:199554869-199554891 TTTTTGTTGATTTTGTGTCTGGG - Intergenic
919615974 1:199809386-199809408 TCTATGTAGATTTTCTGAATGGG + Intergenic
920018546 1:202934931-202934953 TGATAGTTGATATTCTGTCTGGG + Intergenic
920473841 1:206255700-206255722 TCTCTGGTGATTGTCTGTATAGG + Intronic
920590555 1:207214757-207214779 TATTTGTAGATTTTCTGCATGGG + Intergenic
921200300 1:212798845-212798867 TAATTGTTGACTGTCTGTCTGGG - Intronic
921270917 1:213469031-213469053 CCTTTTGTGATTTGCTGTCTTGG + Intergenic
921935070 1:220788181-220788203 ACTTTGTTAATGTCCTGTCTGGG + Intronic
921998295 1:221446102-221446124 TATTTGTTTGTTTTCTGTTTTGG + Intergenic
922086787 1:222356668-222356690 TGTATGTTGATTTTGTGTCATGG - Intergenic
922105029 1:222506223-222506245 TCTTTGGAGATTCTCTGTATAGG - Intergenic
922265342 1:223978741-223978763 TCTTTGGAGATTCTCTGTATAGG - Intergenic
922319514 1:224473738-224473760 TCTTTGTTGATTTTCTGTCTAGG - Intronic
923767267 1:236903772-236903794 TCTTTGCCGAGTTTCTCTCTGGG - Exonic
923870471 1:237988094-237988116 TTTTTTTTTTTTTTCTGTCTGGG - Intergenic
923886348 1:238161731-238161753 TCTTTATTGAGTTTCTGTCTGGG + Intergenic
923960303 1:239074394-239074416 TGTTTGTTAATTTTCTGTCTGGG - Intergenic
924347203 1:243083742-243083764 TCTTTGGAGATTCTCTGTATAGG - Intergenic
924792459 1:247265369-247265391 TGTTTATTGATCTTCTGTATTGG + Intergenic
1063088891 10:2843821-2843843 GCTTACTTGATTTTCAGTCTAGG - Intergenic
1063633894 10:7762348-7762370 TGGTTGTTATTTTTCTGTCTTGG - Intronic
1063704083 10:8414010-8414032 TCTTTGTGCATTTACCGTCTAGG + Intergenic
1063774720 10:9249298-9249320 TCTTTGTTGATTTTCTATTTAGG - Intergenic
1063827775 10:9917903-9917925 TCTTTATTGATTATTTGTTTGGG + Intergenic
1064434504 10:15299489-15299511 TTTTTTTTGTTTTTTTGTCTAGG + Intronic
1064446829 10:15401980-15402002 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
1065419289 10:25523678-25523700 TCCTTGTTGATCTTCTGTTTAGG - Intronic
1065511838 10:26487027-26487049 TCTGAGTTCATTTTATGTCTTGG - Intronic
1065711681 10:28524159-28524181 TCTTTATTGATATTCTGTATTGG + Intergenic
1065856291 10:29832915-29832937 GCTTTGTTGCTTTTCTAACTGGG - Intergenic
1065878343 10:30017152-30017174 TCTATTTTTATTTTCTGTATGGG - Exonic
1066101033 10:32118804-32118826 TCTTTGTTTCATTTTTGTCTTGG - Intergenic
1066132793 10:32410347-32410369 TACTTGTTGACTATCTGTCTTGG + Intergenic
1066151917 10:32630610-32630632 CCTTTGTTGATTTTTTGTCTGGG - Intronic
1066565652 10:36719151-36719173 TCTTTGTTCATTTTCATTCTTGG - Intergenic
1066729149 10:38421133-38421155 TCTTTGGAGATTCTCTGTATAGG + Intergenic
1066754225 10:38693864-38693886 TCTTTGTTGTTGTTATGTTTTGG - Intergenic
1067075725 10:43180313-43180335 TTTTCTTTGATTTTCTGTTTTGG + Intronic
1067126458 10:43520282-43520304 TCTTTGTTGATTGTATGGCCTGG + Intergenic
1067233996 10:44432603-44432625 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
1067398982 10:45953562-45953584 TCTTTGGTGATTTCTTGCCTGGG - Intergenic
1067654899 10:48184109-48184131 TCTTTGTTAATCTTTTGTTTTGG - Intronic
1067867303 10:49922775-49922797 TCTTTGGTGATTTCTTGCCTGGG - Intronic
1067959653 10:50833976-50833998 TCCTTGTGGATTCTCTGTCCAGG - Intronic
1068017069 10:51530646-51530668 CCTTTGTTGATATTTTGCCTGGG + Intronic
1068062688 10:52088881-52088903 TCATTATTGATTTTCTGATTAGG - Intronic
1068234644 10:54217803-54217825 TATTTGTTGATTTTCTGCCCTGG - Intronic
1068423512 10:56825105-56825127 TCTTTATTTTTTTTCTGGCTGGG - Intergenic
1068684368 10:59854480-59854502 TCTTTGTTGCTTAGCTCTCTTGG - Intronic
1068895696 10:62197948-62197970 TCTTTGATGGATTTCTGCCTTGG + Exonic
1069113101 10:64470732-64470754 TCTTTGTTGACTTGCTGTCTTGG - Intergenic
1069264056 10:66436450-66436472 TCTTTGTTGGTTTAAAGTCTGGG + Intronic
1069684985 10:70312222-70312244 TCTTGGTTGTTTTTGTGTCCAGG - Intronic
1070080750 10:73184419-73184441 TCCTTGCTGATTTTCTGTCTAGG - Intronic
1070561902 10:77574508-77574530 TTCTTTTTGATTTTCAGTCTGGG - Intronic
1071015622 10:80994276-80994298 TCTTTGTTGACTTTCTGTTTTGG + Intergenic
1071963325 10:90827820-90827842 TCTTTGTTGGTTTTCTTTCTGGG - Intronic
1071972534 10:90922543-90922565 TCTTTGTCAATGTTTTGTCTTGG - Intergenic
1072217072 10:93296411-93296433 TTCTGGTTGATTCTCTGTCTTGG + Intergenic
1072993895 10:100226021-100226043 TTTCTGTTGATTTTCTATTTTGG - Intronic
1073943311 10:108722556-108722578 TCTTTGTTAGCTTTCTGCCTTGG - Intergenic
1074009290 10:109460261-109460283 ACTTTGTTGTAATTCTGTCTCGG - Intergenic
1074226648 10:111490905-111490927 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1075049184 10:119169922-119169944 TCTGTGTTTATCTTCTGTGTTGG + Intronic
1075251796 10:120884770-120884792 ACTTTGTTCATTTTCTCACTAGG - Intronic
1075528544 10:123206368-123206390 CCTTTGTTGGTTTTATGTGTTGG + Intergenic
1075963606 10:126590280-126590302 TTTTTGCTAATTCTCTGTCTTGG - Intronic
1075990081 10:126828852-126828874 TTTTTGTTGATTTTCTGTCAAGG - Intergenic
1076916584 10:133425511-133425533 TCTTAATTTATTTTCTGTCTTGG - Intergenic
1076936688 10:133570306-133570328 TGTTAATTTATTTTCTGTCTTGG - Intergenic
1076973785 11:155514-155536 TCTTTGGAGATTCTCTGTATAGG - Intergenic
1077586466 11:3457684-3457706 TCTTTGTTTTTTTTCAGACTGGG + Intergenic
1077682594 11:4257348-4257370 TCTTGGTTAAATTTATGTCTGGG + Intergenic
1077687440 11:4309389-4309411 TCTTGGTTAAATTTATGTCTGGG - Intergenic
1077692608 11:4360580-4360602 TCTTGGTTAAATTTATGTCTGGG - Intergenic
1077738324 11:4816404-4816426 TCTTTATTGGTTTTCTGTCTGGG + Intronic
1077826375 11:5812734-5812756 TCCTTGTTGATTATCTATCTGGG - Intronic
1077843173 11:5996903-5996925 TCTTTCCTGCTTCTCTGTCTGGG - Intergenic
1078678922 11:13456678-13456700 TCTTTGTGCATTGTCTGTTTTGG - Intronic
1078746650 11:14122068-14122090 TCTTTGTTTTTATTCTGTTTGGG + Intronic
1078786197 11:14496352-14496374 TGTATGTTGATTTTGTGTCCTGG - Intronic
1078944727 11:16051807-16051829 TCTTTCTTCCTTTTCTTTCTGGG + Intronic
1079068875 11:17325233-17325255 ACTTTGTTGATTTTCTGTCTGGG + Intronic
1079684677 11:23343396-23343418 TCTTTTTAGATTTTCTTTATAGG - Intergenic
1079808617 11:24965422-24965444 ATTTTGTTGATATTCTTTCTTGG - Intronic
1079809178 11:24973984-24974006 TCTTTGTTAATTTTCTGTCTTGG + Intronic
1080462380 11:32466544-32466566 TCTTTGTGTATTTGCTGGCTTGG - Intergenic
1080904724 11:36530855-36530877 TCCTTGCCAATTTTCTGTCTAGG + Intronic
1080973724 11:37309177-37309199 GCTTCTTTGATTTTCAGTCTAGG + Intergenic
1081210801 11:40331385-40331407 TGTTGGTTGATTTTATATCTTGG - Intronic
1081400612 11:42637786-42637808 TCTCTGTTGATTTTTTTTTTGGG - Intergenic
1081413517 11:42786969-42786991 TGTTTGCTAATTTTCTGTTTGGG + Intergenic
1082111636 11:48283062-48283084 TCTTTGTTGACTTTATGTCTTGG + Intergenic
1082147303 11:48685589-48685611 TCCTTGTTAACATTCTGTCTCGG - Intergenic
1082670959 11:56035726-56035748 TCCTTGTTAATTTTCTGTCTTGG - Intergenic
1082754492 11:57060396-57060418 TTCTTGTGGATTTTCAGTCTGGG - Intergenic
1082917627 11:58454690-58454712 AATTTGTTGATTTTCTGTAGTGG - Intergenic
1082934988 11:58647037-58647059 TCTTTTTTGAGTTTCTGTAATGG + Intronic
1082935224 11:58649379-58649401 TATTTGTTGATTTTCTCTTTGGG + Intronic
1084496506 11:69507315-69507337 TGTTTTTTGATTTTTTTTCTTGG + Intergenic
1085194098 11:74656920-74656942 TCTTTGTTGATTTTCTGTGTAGG + Intronic
1085223717 11:74898849-74898871 TCTTTGTTGATTTTCTGTCTGGG - Intronic
1085474953 11:76783682-76783704 TCTTTGTGGATTTGCGGTCGGGG + Intronic
1085648180 11:78241899-78241921 TCCCTGTTGATTTTCTGTCTAGG - Intronic
1085659578 11:78351452-78351474 TCTTTGTTGATTCTCAGCCTGGG + Intronic
1085894058 11:80615891-80615913 GCTTTGTTTATTATCAGTCTTGG + Intergenic
1086013118 11:82130210-82130232 CCTTTGTGGTTTTTCTTTCTTGG + Intergenic
1086073669 11:82826773-82826795 TCTTTGTTCATTTTTTAACTAGG + Intronic
1086249111 11:84793449-84793471 TCTTTGTTGATTTTCTTTCTGGG + Intronic
1086280004 11:85174061-85174083 TTTTTGTTAATTTTCTGTCTTGG - Intronic
1086524364 11:87707944-87707966 TCTTTGTTGATTTTCTCTCTGGG + Intergenic
1086547968 11:88020543-88020565 TCTTTGTTGAGTTTCTGTCTGGG - Intergenic
1086568902 11:88260617-88260639 TCTTTGTTAATTTTCTGCCTTGG + Intergenic
1086592935 11:88537330-88537352 TTTTTGGTGTATTTCTGTCTAGG - Intronic
1086847612 11:91771259-91771281 TCTTTGTTGATTTTCTCTCTGGG + Intergenic
1086905577 11:92414607-92414629 GCTTGGATGATTTTCTTTCTTGG + Intronic
1087068758 11:94053999-94054021 TCCTTGCTGATTTTCTGTTTAGG + Intronic
1087114277 11:94507805-94507827 TCTTTCTCCATTTTCTTTCTGGG + Intergenic
1087356482 11:97100341-97100363 TCTTTGTTAGTTTTCTGCCTTGG - Intergenic
1087392075 11:97548597-97548619 TGTTTATTGATTTTCTATCTGGG - Intergenic
1087416786 11:97866737-97866759 TCTATGCTGATTTCCTTTCTTGG + Intergenic
1087416988 11:97869752-97869774 TCCTAATTGATTTTCAGTCTGGG + Intergenic
1087503522 11:98991224-98991246 TTATTGTTGATTTTCTGTCTAGG + Intergenic
1087516894 11:99175235-99175257 TATTTTTTTATTTTCTGTTTTGG - Intronic
1087690440 11:101315350-101315372 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1087720109 11:101653710-101653732 TCCTTACTGATCTTCTGTCTGGG - Intronic
1087888018 11:103502841-103502863 TCTTTGTTGGTTTAAAGTCTAGG - Intergenic
1088354644 11:108929842-108929864 TTTTTATTGACTTTCTGCCTAGG + Intronic
1088375711 11:109139558-109139580 TCTTTGTTAATTTCCTGTCTAGG + Intergenic
1088386364 11:109261699-109261721 TTCTTGTTAATTTTGTGTCTGGG + Intergenic
1089576493 11:119447996-119448018 TTTTTCTTGTTTTTGTGTCTTGG + Intergenic
1089604296 11:119632838-119632860 TCCTTTTTGATTTACTCTCTTGG - Intronic
1090058709 11:123445353-123445375 TTTTTGTTGATTTTCAGGGTTGG + Intergenic
1090111451 11:123914001-123914023 TCCTTGTTGATTTTCTGTCTAGG - Intergenic
1090209119 11:124904885-124904907 TCCTTTTTAATTTTCTGTCTGGG + Intergenic
1090316948 11:125799978-125800000 TCTTTGTTGATTTTCTATCTGGG + Intergenic
1090318021 11:125814359-125814381 TCTGTGTTGATTTTCTGTCTGGG + Intergenic
1091320949 11:134649800-134649822 TTTTTCTTGATTTTCTCTATTGG + Intergenic
1092813196 12:12290474-12290496 TCTTTGTTGCTATTCTTGCTGGG - Intergenic
1093060459 12:14597275-14597297 TCTTTGTTAATTTTCTGCCTAGG + Intergenic
1093259266 12:16915026-16915048 TGTTTGTTGACTTTCTGTCTGGG + Intergenic
1093476645 12:19562613-19562635 TCTTTATTGATTTTTTTTTTTGG + Intronic
1093581409 12:20787668-20787690 TCTTTGTTGATTTTCTTTCTGGG + Intergenic
1093762899 12:22930070-22930092 CCTTTCTTCATTTACTGTCTTGG + Intergenic
1093951805 12:25170570-25170592 TCTTTGTTGACTTTCTGTCTTGG - Intronic
1094241408 12:28229970-28229992 TCTTTGTTGACTTTTTATCAAGG + Intronic
1094420051 12:30261322-30261344 TCTTTTTTGATTTTCTGTCTGGG - Intergenic
1094768168 12:33621356-33621378 TCTTTATTTATTTTCTCTCTGGG - Intergenic
1095091945 12:38115781-38115803 TTTTTGTTTATTTTTTGTTTTGG - Intergenic
1095167046 12:38985373-38985395 TCTTTTTTGACTTTCTGTGTTGG - Intergenic
1095212915 12:39514151-39514173 TCTTCACTGATTTTCTGTCTGGG - Intergenic
1095401105 12:41815214-41815236 TATTAGTTTATTTTCTGTATAGG + Intergenic
1095730553 12:45501837-45501859 CCTTTCTGGATTTCCTGTCTTGG - Intergenic
1096098677 12:48956061-48956083 TCTTTGCTGCTATTTTGTCTTGG - Intronic
1096450953 12:51740709-51740731 TCTTTGTTGATTTTCTGTCTGGG + Intronic
1096930598 12:55204512-55204534 TCTTTTTCGATTTTATGTCTAGG - Intergenic
1097025687 12:56053747-56053769 TCTTTTTTGTTTTTGTTTCTTGG + Intergenic
1097141645 12:56907690-56907712 TCTTTCTTGACTTTTTGTTTGGG + Intergenic
1097583227 12:61483656-61483678 TCTTTGTTAATTTTCTGCCTTGG - Intergenic
1097774588 12:63630657-63630679 TCCTTGTTAACTTTCTGTCTCGG - Intronic
1097809463 12:64002609-64002631 TCTTTGGTAGGTTTCTGTCTAGG - Intronic
1097898241 12:64847930-64847952 TTTTTGTTGATTTTGTGTCTGGG + Intronic
1097982674 12:65750516-65750538 TCTTTATGGATTATCTGTGTGGG + Intergenic
1098453369 12:70645184-70645206 TTTTTATTGGTTTTCTGTGTTGG + Intronic
1098504180 12:71229876-71229898 TCTTTGTTGATTTTCTGTCTGGG - Intronic
1098965154 12:76779966-76779988 TATTTGTTGTTTTTATATCTGGG + Intronic
1099192613 12:79575379-79575401 TCTTTGTTGAATTTCTCTCTAGG - Intronic
1099423229 12:82490427-82490449 TCTTTGTTGCTTTTTAGTTTTGG - Intergenic
1099609855 12:84854410-84854432 TTTTTGTTGATTTTCTGTCTGGG + Intergenic
1099763917 12:86957979-86958001 TCTTTATTGATTTTCTACCTAGG + Intergenic
1099849745 12:88077315-88077337 ACTTTGTTTATTATCTGTCAGGG + Exonic
1100026741 12:90139011-90139033 TTTTTGTTAATTTTTTGTCTAGG + Intergenic
1100026773 12:90139583-90139605 GGTTTGTTGATTTTCTGTGGTGG + Intergenic
1100217570 12:92468179-92468201 TCTGTGTTTATTTTCTCCCTAGG - Intergenic
1100300951 12:93307354-93307376 TTGTTGTTGTTTTTCTGTTTAGG - Intergenic
1100484394 12:95010734-95010756 TCCTTTTCGATATTCTGTCTGGG + Intergenic
1100715852 12:97304385-97304407 TCTGTCCTGATTTTCTGTCCTGG - Intergenic
1101082047 12:101196698-101196720 TCTTTGTTGTTCTTTTTTCTTGG - Intronic
1101490947 12:105208788-105208810 TCTTTTTGGATTTTTGGTCTTGG - Intronic
1101556269 12:105812906-105812928 TCTTCTTTGATTTTATGACTAGG - Intergenic
1101642066 12:106594041-106594063 ACTGTGTTGATTTTCTTTTTGGG - Intronic
1102321278 12:111936830-111936852 TGTTTATTGATTTTCTTCCTAGG - Exonic
1103155637 12:118682286-118682308 TCTTTGTTGGTTTTGTCACTAGG - Intergenic
1103168253 12:118789602-118789624 TCTTTCTTTTTTTTCTTTCTTGG + Intergenic
1103502150 12:121411270-121411292 TTTTTCTTCATTTTCTTTCTGGG + Intronic
1103994292 12:124819181-124819203 TCTGTTTTGATTTTGGGTCTAGG - Intronic
1104075996 12:125390613-125390635 TCTTTCTCGTTGTTCTGTCTCGG + Intronic
1104364839 12:128167469-128167491 TGTCTGTTCATTTTATGTCTTGG - Intergenic
1105315471 13:19256638-19256660 TCATTATTGATTTTTTATCTGGG - Intergenic
1106371122 13:29134414-29134436 TCTTTACTTATCTTCTGTCTGGG + Intronic
1106552008 13:30780344-30780366 CCTGTGTCAATTTTCTGTCTGGG - Intergenic
1106646754 13:31642971-31642993 ACTTTTTTGAATTACTGTCTGGG - Intergenic
1106723383 13:32458732-32458754 TTTTTGTTAATTTTCTGTGTAGG - Intronic
1107085465 13:36423122-36423144 TGTTTGTTGATTGTCTGTATGGG - Intergenic
1107193542 13:37620141-37620163 TTTTTATTACTTTTCTGTCTGGG - Intergenic
1107203359 13:37750317-37750339 TGTATGTTGATTTTGTTTCTAGG + Intronic
1107211125 13:37855474-37855496 TCTTTGTTGATATTCTGTCTGGG - Intronic
1107246958 13:38308267-38308289 TCTTTGTTTCTTTTCTGTTTTGG - Intergenic
1107262312 13:38508390-38508412 ACTTTGTTGAATTTCTGTATTGG + Intergenic
1107267127 13:38569163-38569185 CCTTTGTTAGTTTTCTGCCTCGG - Intergenic
1107369954 13:39734647-39734669 TCTTTTTTAATTTTCTCTCTGGG + Intronic
1107479153 13:40771139-40771161 TCTTGGTTCATTTCGTGTCTCGG - Exonic
1107582430 13:41805497-41805519 TCTTCGTTGATTTTCTGTCTGGG - Intronic
1107701281 13:43050951-43050973 TTTTTGTTGTTTTTGTTTCTTGG + Intronic
1107847130 13:44526553-44526575 TCTCTCTTTCTTTTCTGTCTTGG - Intronic
1107900498 13:45008430-45008452 TCTTTTTTTATTTTGTGCCTTGG - Intronic
1108037775 13:46309555-46309577 TATTTATTGACTTTCTGTCATGG + Intergenic
1109051237 13:57483927-57483949 TCTTCACTGATTTTCTGTCTGGG - Intergenic
1109120924 13:58455940-58455962 TCTTTGTTGGTTTTCTGCCTTGG - Intergenic
1109385688 13:61626790-61626812 TCTTTGTTAACCTTCTGTCTCGG + Intergenic
1109458132 13:62620458-62620480 GCTTTGGTGGTTTTCTGTCATGG - Intergenic
1109548794 13:63864810-63864832 TGTATGTTGATTTTGTGTCCTGG - Intergenic
1109576087 13:64261417-64261439 TATTTTATTATTTTCTGTCTAGG - Intergenic
1109669031 13:65580484-65580506 TCTTTGTTTATTGTTTATCTTGG - Intergenic
1109726607 13:66349319-66349341 ACTTTGTTTGTCTTCTGTCTCGG + Intronic
1109807925 13:67468521-67468543 TCTTTGTTAGTTTTCTGTGTAGG + Intergenic
1110382520 13:74870133-74870155 TCTTTGTTGCTATTGTGTTTTGG - Intergenic
1110426737 13:75375633-75375655 TCTATCTTGTTTCTCTGTCTTGG + Intronic
1110486841 13:76055334-76055356 TCTTTGTTGATTTCCTGTCTGGG - Intergenic
1110732935 13:78901725-78901747 TCTTTGCTGACTTTTTTTCTGGG - Intergenic
1110897920 13:80779502-80779524 TCTCTGTTGATTTTTTTCCTAGG + Intergenic
1111137275 13:84064350-84064372 TCTTTGTCGATTTTCTGTCTAGG + Intergenic
1111225806 13:85269070-85269092 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
1111328730 13:86734023-86734045 TCTTTCTTGATTTTCTGTATTGG - Intergenic
1111363128 13:87203156-87203178 ATTTTGTTGATTTTCTTTATTGG + Intergenic
1111388950 13:87565446-87565468 TCTTCATTGATTTTTTGTGTTGG - Intergenic
1111446870 13:88357557-88357579 TATTTGTTGATTTGCTATCTAGG - Intergenic
1111671552 13:91337407-91337429 TCATTGTTGATTTTCTGTCTAGG + Intergenic
1111851281 13:93578402-93578424 TATTTCTTCATATTCTGTCTTGG + Intronic
1112248178 13:97753518-97753540 TATTTATTTATTTTCTGTTTTGG - Intergenic
1112372227 13:98804099-98804121 GGGTTGTTGAGTTTCTGTCTGGG - Intronic
1112814857 13:103261382-103261404 TCTTTGTTAAATTTCTGTGTAGG + Intergenic
1112833580 13:103484820-103484842 TCTTTATTGTTTTTTTGTCTGGG + Intergenic
1112854697 13:103753374-103753396 TCTTCTTTGAATTTCTTTCTAGG + Intergenic
1113443264 13:110346245-110346267 TCTTAAATGACTTTCTGTCTGGG - Intronic
1113631467 13:111889129-111889151 CTTTTGTTGATTTTCTCTATTGG + Intergenic
1113658477 13:112086546-112086568 TCTTTTTTGATTTCCTGTGCTGG + Intergenic
1114157653 14:20123586-20123608 TCCTTACTGATTTTCTTTCTGGG - Intergenic
1114226606 14:20744377-20744399 CCTTAGTTGATTTTCTCACTGGG - Intronic
1114506774 14:23221584-23221606 TGTTTGTTGATTTTCTACCTGGG - Intronic
1114756471 14:25265817-25265839 TATTTGTTGACTTTCTGTCTTGG + Intergenic
1114783483 14:25567416-25567438 TCTTTGTTGATTTTCTGTTTGGG + Intergenic
1114984903 14:28214578-28214600 TCTTTGTTGAGTTTCTGCCTGGG + Intergenic
1115010033 14:28535139-28535161 TCTTTGTTACTTCTCTGCCTTGG + Intergenic
1115265249 14:31493770-31493792 TCCTTGTCAACTTTCTGTCTTGG - Intronic
1115357433 14:32463190-32463212 TCCTTATTAATTTTCTGTCTTGG - Intronic
1115604258 14:34984340-34984362 TCTTTGGTTATTTTCAGTCTTGG + Intronic
1115931504 14:38501802-38501824 TCTTTGCTGATTTTCTGCCTTGG + Intergenic
1116021364 14:39466007-39466029 TCCTTGTTGATTTTTTTTTTTGG + Intergenic
1116085617 14:40233955-40233977 TCTTTGCTGATTTTCTGTTGGGG + Intergenic
1116355073 14:43917706-43917728 TCTTTGTTGGTTTTCTGTTTGGG - Intergenic
1116392051 14:44404488-44404510 TCTTTTGTCATTGTCTGTCTGGG - Intergenic
1116482559 14:45409144-45409166 TGTTTTTTGATTTTCTGTTTTGG + Intergenic
1116766228 14:49073492-49073514 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
1116889385 14:50252876-50252898 TCTTTGTCGAGGTTCTGCCTGGG - Intronic
1117003097 14:51391691-51391713 GCTTTGTTGTGTCTCTGTCTTGG + Intergenic
1117103582 14:52376188-52376210 TCTTTGGTGATTTTCTGTTTTGG + Intergenic
1117506210 14:56405646-56405668 TCTTTGTGAGTTTTCTGCCTCGG - Intergenic
1117624692 14:57623176-57623198 TCTTTGTTGGTTTAATATCTGGG - Intronic
1117634520 14:57727931-57727953 TCTTGGTTGATTTTCTGTATGGG + Intronic
1117691176 14:58308175-58308197 TCTATGGTGATTTTCTGTGTTGG + Intronic
1117869986 14:60190205-60190227 TCTTGCTTGCTTTTCTGTTTAGG - Intergenic
1118644468 14:67824098-67824120 TCTTTGTTGTTTTTGAGACTAGG + Intronic
1118823797 14:69362488-69362510 TCTTGGCTGGTTTTCTGTGTTGG + Intergenic
1118834637 14:69468576-69468598 TCTTTCTTTCTTTTCTTTCTGGG + Intergenic
1119015044 14:71042219-71042241 TCTTTGTTGATTTTCTGTCTAGG + Intronic
1119050592 14:71364616-71364638 TTTTTGGTGATTATGTGTCTTGG + Intronic
1119279846 14:73396530-73396552 TTTTTGTTGTTTTTTTGTTTTGG + Intronic
1119604656 14:76004507-76004529 TCTTTGATTTTTTTCTGTTTAGG + Intronic
1120068209 14:80070646-80070668 TCTTTGTAAAATTTCTGGCTAGG - Intergenic
1120094492 14:80373566-80373588 TATTTCTTAATTTTCTCTCTTGG - Intronic
1120260950 14:82185132-82185154 TACTTATTAATTTTCTGTCTGGG + Intergenic
1121170079 14:91846349-91846371 TTCTTCTTGATCTTCTGTCTTGG - Intronic
1122304662 14:100754980-100755002 TTTTTGTTGACTTTCTCTGTTGG - Intergenic
1122431672 14:101653774-101653796 TTTTTGTTGGGTTTTTGTCTTGG + Intergenic
1122458472 14:101875942-101875964 ACTTTGTAGTTTTTGTGTCTGGG + Intronic
1123808689 15:23901210-23901232 TCTTTATTATTTTTCTCTCTAGG - Intergenic
1123954405 15:25319808-25319830 TCTTTATTGATTTTCTGTCTAGG + Intergenic
1124091149 15:26602351-26602373 TCTTTGTTGATCTTCTATCGGGG - Intronic
1124131646 15:26993749-26993771 TCTTTGTTGATTTTCTGTCTGGG + Intronic
1124552543 15:30694970-30694992 TCCTTTTTGATTTTCTGCCTGGG - Intronic
1125007445 15:34833697-34833719 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
1125271465 15:37943303-37943325 ACTTTGTTCAATTTCTGTCCTGG + Intronic
1125276732 15:38001047-38001069 TCTTTGTTGCTTTTCAGTCTAGG + Intergenic
1125316553 15:38438479-38438501 TCTTTGTTGACTTTCTGCCTTGG + Intergenic
1125565435 15:40674523-40674545 TCTTTGTTGATGTTCTGTCTGGG + Intergenic
1126523599 15:49624151-49624173 TTTTTGTTCACTTTCTGTTTGGG + Intronic
1126720647 15:51574946-51574968 TTTTTGTTGCTCTTCTCTCTAGG - Intronic
1126816012 15:52454456-52454478 TCCTTGTTGATTTTCTGTCTGGG - Intronic
1127033812 15:54892760-54892782 TTTTTGTTGATTTTCTGTCTAGG + Intergenic
1127177774 15:56379589-56379611 TGTTTGTTGAGTTTCTTTCTGGG + Intronic
1128000637 15:64188233-64188255 TCTCTGTAGATTTTCTGTCTAGG - Intronic
1128871583 15:71161297-71161319 TCTTTGTTGATTGTCTGTCTAGG + Intronic
1129586172 15:76868506-76868528 GCTTTCTTGATTTTCTTTTTTGG - Intronic
1129890046 15:79065863-79065885 TTTTTGTTAATTGTCAGTCTAGG + Intronic
1130130299 15:81135248-81135270 CTTTTGTTGATTTTCTGTTTAGG + Exonic
1130293804 15:82628261-82628283 TCTTTCATGATTTCCTGTATTGG - Intronic
1130660331 15:85826517-85826539 TCTTTGGGCAGTTTCTGTCTAGG - Intergenic
1130727147 15:86450942-86450964 TTTATGTTGATTTTTTTTCTTGG + Intronic
1131589929 15:93737984-93738006 TCCTTGTTAACTTTGTGTCTTGG + Intergenic
1131703017 15:94960350-94960372 TATCTGTTGATTTTCTGTTTAGG - Intergenic
1131705265 15:94987616-94987638 TCATTGCTGATTTCCTGTCGAGG - Intergenic
1131725721 15:95221785-95221807 TCTTTATTGATTTTCTGTCTGGG + Intergenic
1131903919 15:97119965-97119987 TCCTGATTGATTTTCTGTCTGGG - Intergenic
1133078608 16:3299992-3300014 TCTTTGTTTATTTTCTTCCCTGG + Exonic
1133543608 16:6782775-6782797 TCTTTGTTAATTTTCTTTCTAGG + Intronic
1133829786 16:9310865-9310887 TTTTTGATGACTTTGTGTCTGGG + Intergenic
1134088851 16:11378928-11378950 TCCTTCTTGATCTTCTGTCTGGG + Intronic
1134298608 16:12969350-12969372 TTTTTTTTTTTTTTCTGTCTGGG + Intronic
1134781435 16:16900670-16900692 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1134825882 16:17283961-17283983 TCTGTGTTTATTCTCTGACTGGG - Intronic
1135501280 16:22998171-22998193 TCTTTGTTCCTGTTCTCTCTAGG + Intergenic
1136663581 16:31788223-31788245 TTTCTGTTAATTTTCTGTCTTGG + Intronic
1136670835 16:31855451-31855473 TCATTATTGATTTTCTGTCTAGG - Intergenic
1136728508 16:32383263-32383285 TCTTTGTTGTTGTTATGTTTTGG + Intergenic
1138127504 16:54451234-54451256 TCTTAGTTCATTTTCTCTTTAGG - Intergenic
1138261491 16:55626649-55626671 ACTTTGTTGACTGTCTGACTCGG - Intergenic
1138864949 16:60806205-60806227 TCTTTGTTGATTTTGTGTCTGGG - Intergenic
1139094447 16:63687780-63687802 TCCTTATTGATTTTTTGTCTGGG - Intergenic
1139104590 16:63812833-63812855 TCATTTCTGATTTTTTGTCTGGG - Intergenic
1140646302 16:77034509-77034531 ACTTTGTTGTTTTTCTTTTTTGG - Intergenic
1141011935 16:80409702-80409724 TTTTTGTTTTTATTCTGTCTTGG - Intergenic
1142446476 16:90142172-90142194 TCTTTGGAGATTCTCTGTATAGG + Intergenic
1202997929 16_KI270728v1_random:134492-134514 TCTTTGTTGTTGTTATGTTTTGG - Intergenic
1142461029 17:93293-93315 TCTTTGGAGATTCTCTGTATAGG - Intergenic
1143061538 17:4206083-4206105 TCTTTGTAGCCTTTCTTTCTGGG + Intronic
1143063835 17:4226781-4226803 GCTTTGTTAATTTTCTCTGTTGG - Intronic
1143311723 17:5997545-5997567 TTTTTGTTGATCTTCAGTCTTGG + Intronic
1143760278 17:9097652-9097674 TTTTTGTTGTTTGTCTGTTTGGG - Intronic
1143882062 17:10037156-10037178 TCTTTGTTCGTTATCTGTCCAGG - Intronic
1144159336 17:12542432-12542454 TCTTTGTTCATTTTATCTCTAGG + Intergenic
1144327730 17:14197794-14197816 TCTTTGTGGTTGTTCTGTCAGGG + Intronic
1144351217 17:14398709-14398731 TCTATCTGGATTTTGTGTCTGGG - Intergenic
1144376745 17:14650562-14650584 TCTTCTTAGATTCTCTGTCTGGG + Intergenic
1144616300 17:16777303-16777325 TCTTTGTTGACTTTCTGTCTTGG - Intronic
1144896403 17:18538356-18538378 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
1145004616 17:19330301-19330323 TCTTTTTTTCTTTCCTGTCTTGG + Intronic
1145135814 17:20405861-20405883 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
1145350782 17:22081218-22081240 TCTTTGTTTATTTTCTGATGGGG - Intergenic
1145386033 17:22412096-22412118 TCTTTGTTGAGCCTCTTTCTGGG + Intergenic
1145832749 17:27930269-27930291 TCTTTGTTGATCATGTTTCTGGG + Intergenic
1146246352 17:31286874-31286896 TCTTAGTTAATTTTCTGTTGAGG + Intronic
1146316615 17:31812355-31812377 TTTTTGTTGCTTTTCGGTTTTGG + Intergenic
1146407352 17:32550599-32550621 TCTTTGTAGATTTGTTTTCTAGG + Intronic
1148134520 17:45283726-45283748 TATTTGTTGCTTTTCTTTCGGGG + Intronic
1149066297 17:52484448-52484470 TTTTTTTTTTTTTTCTGTCTAGG + Intergenic
1149405259 17:56342838-56342860 TCTTTGTTAATTTTCTGTCTTGG + Intronic
1149507582 17:57207590-57207612 TCTGTCCTGATTTCCTGTCTGGG + Intergenic
1150022000 17:61626158-61626180 TCGTTGCTGATTTTCTATCTAGG + Intergenic
1150364112 17:64565996-64566018 TTTTTATTGTTTTTCTCTCTTGG - Intronic
1150540357 17:66091126-66091148 TCCTTATTAATTTTCTTTCTGGG - Intronic
1151048610 17:70950055-70950077 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
1152734737 17:81991854-81991876 TCTGTGTTCATGTCCTGTCTGGG - Intronic
1153062392 18:1007627-1007649 TTATTTTTGATTGTCTGTCTTGG + Intergenic
1153193292 18:2566540-2566562 TGTTTGTTTTTTTGCTGTCTGGG + Intronic
1153313241 18:3698600-3698622 TCTCTGATGATTATGTGTCTTGG + Intronic
1153425978 18:4964023-4964045 TATTTGTTGATTTTCTATCTGGG - Intergenic
1153429683 18:5002375-5002397 TCTTTGCTGATTTGCTGTCTGGG - Intergenic
1153729449 18:7994420-7994442 TCTTTGTTGATTTTCTATCTAGG - Intronic
1153869699 18:9306270-9306292 TCTTTGTTGACTTTCTGTTTTGG - Intergenic
1153903785 18:9642337-9642359 TCTTTGTTTGTTTTCGGTTTTGG - Intergenic
1154183985 18:12164831-12164853 TCTTTGTCAATTTTCTTTCTGGG + Intergenic
1154931120 18:20997579-20997601 TCTTTGTTGATTTTCTGTCTAGG - Intronic
1155105225 18:22657703-22657725 TCTTTATTTGTTTTCTGGCTGGG + Intergenic
1155180485 18:23341245-23341267 TTATTGTTGTTTTTCTCTCTGGG - Intronic
1155282520 18:24254290-24254312 TCTTTGTTGATTTTCTGTCTGGG - Intronic
1155681943 18:28498642-28498664 TTTTTGTTGAGCTTCTGTCTGGG + Intergenic
1155773971 18:29735899-29735921 TCTTTGTTAGTTTTCTGCCTTGG + Intergenic
1155849642 18:30755034-30755056 TCTTTGTTGATTTTCTCTCTTGG - Intergenic
1156057325 18:33023174-33023196 TCCTTAATGATTTTCTGTTTAGG - Intronic
1156073326 18:33239800-33239822 TCTTTGTTGGGTTTTTGTCTAGG - Intronic
1156121824 18:33853035-33853057 TTTGTGATGATTTTCTTTCTAGG - Exonic
1156227303 18:35122038-35122060 TTTTTGTTTATTTGCTTTCTAGG - Intronic
1156329316 18:36104593-36104615 TCTCTGTTTTTGTTCTGTCTGGG - Intergenic
1156340810 18:36209175-36209197 TCTTTTTTTTTTTTCTTTCTTGG + Intronic
1156563096 18:38151725-38151747 TCTTTTTTAATTTTCTGTCTTGG - Intergenic
1156650745 18:39224091-39224113 TCTTTCTTTAAATTCTGTCTAGG - Intergenic
1157064928 18:44337854-44337876 TCTTTGTTGATTTTTTAAATTGG + Intergenic
1157371371 18:47115348-47115370 TTTTTGTTGTTGTTCTCTCTAGG - Exonic
1158190841 18:54827040-54827062 TCTTTCTTTTATTTCTGTCTGGG + Intronic
1158613352 18:58963051-58963073 CCTTTGTTGAGTTTATGTTTTGG + Intronic
1158733070 18:60047240-60047262 TCTTTGTTTATTTTGAGACTGGG + Intergenic
1162858261 19:13486510-13486532 TATCTTTTAATTTTCTGTCTGGG - Intronic
1163880537 19:19917523-19917545 TGTGTGTTAATTTTCTGTTTTGG + Intronic
1164992819 19:32696790-32696812 TCAGTGTTAATTTCCTGTCTTGG - Intronic
1166285418 19:41823378-41823400 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1166407986 19:42536357-42536379 TCTTTGTTGATTTTCTGTCTGGG + Intronic
1166790837 19:45397505-45397527 TCTTTCTTTCTTTTCTATCTCGG + Intronic
1166918158 19:46210153-46210175 TCTTTGTGGCTTTTCTGTTAAGG - Intergenic
1166920450 19:46225861-46225883 TCTTTGTGGCTTTTCTGTTAAGG - Intergenic
1167282466 19:48577857-48577879 TATTTGTTGATTTATTTTCTGGG - Intronic
1167551419 19:50163339-50163361 TTTTTCTTGACTTTCTCTCTAGG - Intergenic
1167675681 19:50883756-50883778 TTTTAGTTGATTTTCTCTATAGG + Intergenic
1168181659 19:54666041-54666063 TCTTTCTAGATTTTCTCACTGGG - Intronic
925232607 2:2247474-2247496 GCTTTGTTAATTTTCGGCCTGGG - Intronic
925408108 2:3621072-3621094 TTCTTACTGATTTTCTGTCTGGG + Intronic
925484009 2:4308118-4308140 TCTTTGTCGATTTTCTGTCTGGG + Intergenic
926445682 2:12939146-12939168 TCTTTGTTGGTTTGCCTTCTTGG + Intergenic
926638441 2:15208495-15208517 TCTTCGTTGATTTTCTGTCTGGG - Intronic
927664749 2:25023024-25023046 TTTTTCTTGTTTTTCTGTTTGGG - Intergenic
927758603 2:25729411-25729433 TCTGTATTGGTTTTCTGTATTGG - Intergenic
928314374 2:30234371-30234393 TGTTTGTTGACTTTTGGTCTGGG + Intronic
928417090 2:31104461-31104483 TCATTGTTGATTTTTTGACAAGG - Intronic
928495184 2:31824073-31824095 TCTCTGTTAATTTTCTATCTGGG + Intergenic
928535272 2:32233830-32233852 TCTTTGTTGATTCTCTGTCTGGG + Intronic
928734355 2:34268617-34268639 TCTTTGTTAGTTTTCTGCTTTGG + Intergenic
928782862 2:34846386-34846408 TCTTTGTTGAGTTTCTGTCTTGG + Intergenic
928896517 2:36271289-36271311 TTTTTGTTTGTTTTCTGGCTGGG - Intergenic
929258009 2:39834140-39834162 TCCTTACTGATTTTCTGTCTGGG + Intergenic
929281398 2:40084270-40084292 TCTTTGTTGATTTTTCCACTTGG + Intergenic
929349431 2:40930946-40930968 TCTATTATGAGTTTCTGTCTTGG + Intergenic
929398921 2:41556975-41556997 TCTTTCTTGATGACCTGTCTAGG - Intergenic
929851536 2:45595531-45595553 ACTTTTCTGATTTTCTGGCTTGG + Intronic
930005625 2:46894201-46894223 TTTTTGTTGTTGTTCTGTTTTGG - Intergenic
930944631 2:57058845-57058867 TCTTTGTTGATTTTCTGTCAGGG + Intergenic
930993607 2:57688690-57688712 TCTTTGCTAGTTTTCTGCCTTGG - Intergenic
931045217 2:58343790-58343812 TCTTTGTTAATTCTTTGTATAGG - Intergenic
931060223 2:58520404-58520426 TGTTTGTTTTTTTTCTTTCTTGG + Intergenic
931161661 2:59699162-59699184 TCTTTGTTAATTTTCTGTCTGGG + Intergenic
931264440 2:60647975-60647997 GCTCTGATGATTCTCTGTCTAGG - Intergenic
931621798 2:64217934-64217956 TCTTTTTAGATTTTCTTTTTGGG + Intergenic
931950748 2:67358689-67358711 TCCTTGTTAACTTTCTCTCTCGG - Intergenic
932008357 2:67950176-67950198 TCTTTGCTGCTTTTCTGGGTTGG + Intergenic
932034549 2:68229439-68229461 TCCTTGCTGATTTTCTTGCTTGG + Intronic
932782819 2:74572850-74572872 TCTTTGTTAGTCTTCTGTCTTGG - Intronic
932946347 2:76236607-76236629 TCTTTGCTAATTTCCTGGCTGGG + Intergenic
932995640 2:76848499-76848521 ACTTTGTTCATTTTCTGTTCAGG + Intronic
933649291 2:84836909-84836931 TTTTTATTGATATTCTGTATTGG + Intronic
934019750 2:87935312-87935334 TCTTTGTTGTTTTTTTTTCATGG - Intergenic
934043671 2:88151931-88151953 TCTTTGTTGATTTTATGTCCAGG - Intergenic
934294169 2:91728226-91728248 TCTTTTTTTATTCTCTGTGTTGG + Intergenic
934317522 2:91938123-91938145 TCTTTGTTGTTGTTATGTTTTGG - Intergenic
935020901 2:99230478-99230500 TCTTTGCTAGTTTTCTGCCTTGG - Intronic
935041619 2:99435067-99435089 GCATTGTTGATTTTATTTCTTGG - Intronic
935437589 2:103052991-103053013 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
935439327 2:103073746-103073768 TCTTCGTTTATTTTCTGTCTGGG - Intergenic
935471727 2:103468715-103468737 GCTTTGTTGATTCTCTTTATTGG - Intergenic
935483494 2:103623057-103623079 TCCTTGTTGATTTTCTGTCTGGG - Intergenic
935751430 2:106237858-106237880 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
935835521 2:107048366-107048388 TTTCTGTTGATTTTCTGTCTGGG + Intergenic
935911896 2:107905778-107905800 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
936006037 2:108889338-108889360 TGCTTTTTGATTTTCTGTCGAGG + Intergenic
936640697 2:114309234-114309256 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
937316323 2:120934040-120934062 TTCTTGTTGATTTTCAGACTAGG + Intronic
937591473 2:123618303-123618325 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
937604693 2:123784350-123784372 TGGTTTTTGATTTTCTGTTTCGG + Intergenic
937613235 2:123889302-123889324 TCTTTGTAGATTTTCTGTTGGGG + Intergenic
937805756 2:126142383-126142405 TCTTTGTTGATTTTTTGGTCAGG + Intergenic
937823401 2:126337267-126337289 TCTTTGTTAGTTTTCTGCCTTGG - Intergenic
938012378 2:127839261-127839283 TGTCTGTTGAATTTCAGTCTGGG - Intergenic
938177628 2:129150064-129150086 TCTTTTTTGATTTTCTGTCTGGG + Intergenic
939160112 2:138577568-138577590 ACTTTGTTCATTTTCTCTGTTGG + Intergenic
939370534 2:141293626-141293648 TTTTTTTTTTTTTTCTGTCTTGG + Intronic
939462837 2:142518914-142518936 TATTTGCTGCTTTTCTTTCTAGG - Intergenic
939592936 2:144088166-144088188 GCTTTCTTGATTTTTTTTCTTGG - Intronic
939664974 2:144940682-144940704 TCTTAGTTCTTTTTCTTTCTGGG - Intergenic
939666243 2:144955123-144955145 TAATTGTGCATTTTCTGTCTAGG + Intergenic
939847433 2:147265361-147265383 CCTTTGTTGATTTTCTGTCCAGG + Intergenic
940395520 2:153186009-153186031 TCTTTGTTAATTTTCTGTCTCGG + Intergenic
940706491 2:157110962-157110984 TCTTTGTTGACTTTCTTATTTGG - Intergenic
940757682 2:157701987-157702009 TCTTTGTTCCTTTTCTGTCTAGG - Intergenic
940852398 2:158701052-158701074 TGTTTGTTTTTTTTCTGCCTTGG - Intergenic
940905176 2:159162597-159162619 TCTGTGCTGGTTTTCTTTCTTGG + Intronic
940934323 2:159474112-159474134 TCCTTGTTAATTTTCTGTTTTGG + Intronic
940948023 2:159640291-159640313 TCTTTGTTGATCTTGTGTCTGGG - Intergenic
941048309 2:160701807-160701829 TCTTTGATCATTTTGTGTATTGG - Intergenic
941138916 2:161752579-161752601 TATTTGTTGATTTTATATCCTGG - Intronic
941338294 2:164272240-164272262 TATCTGTTCATTTTCTGTCTGGG - Intergenic
941346645 2:164377355-164377377 TCTTTGTTTATTTCCTTTATTGG - Intergenic
941560462 2:167037147-167037169 TCTTTGTTGGTTTTCTGTCTGGG - Intronic
941583373 2:167327559-167327581 TGTATGTTGATTTTCTGTCCTGG + Intergenic
941861815 2:170290226-170290248 TCTTTGTTGATTTTCTCTCTGGG + Intronic
942007131 2:171715532-171715554 TCTTTTTTGCTTTTGTGTTTTGG + Intronic
942040183 2:172053513-172053535 ACATTGTTGTTTTTCTCTCTTGG + Intronic
942356394 2:175116611-175116633 TCTTTCTTGATTTTCTTCCTAGG - Intronic
942675967 2:178427265-178427287 TATTTTTTGATTTACTGTATTGG + Intergenic
942814045 2:180031061-180031083 TCTTTGTTGATTTTCTATCTGGG + Intergenic
942925676 2:181429458-181429480 TTTTCGTTCTTTTTCTGTCTTGG + Intergenic
943052188 2:182927919-182927941 TATTTGTTTATTTTCTTTTTTGG - Intronic
943236761 2:185331569-185331591 TATTTATTAATTTTCTGGCTGGG + Intergenic
943642311 2:190373142-190373164 TCTTGGTTGATTTCATATCTTGG + Intergenic
943699605 2:190975260-190975282 TCTCTGGTGCTTTTCTGTCCAGG - Intronic
943723045 2:191225170-191225192 TATTTATTGACTTTCTGTCTTGG - Intergenic
943873070 2:193026520-193026542 TCTTTGTTGAGATTCTGTCTGGG - Intergenic
943913380 2:193596644-193596666 TCTCTGTTGATTTTCAGTCTTGG - Intergenic
943923737 2:193743856-193743878 TCTTTATTAATTTTCTGCTTTGG - Intergenic
944095788 2:195966497-195966519 TCTTTGTTGGTTTTCTGTCAGGG + Intronic
944187279 2:196962979-196963001 TCTATGTATATTTTCTGTCAGGG + Intergenic
944621478 2:201520261-201520283 TTCTTTTTGATTTTCTTTCTAGG - Intronic
944737686 2:202582724-202582746 TATTTGTTGATTTTCTGTCTTGG + Intergenic
944921823 2:204422166-204422188 TCTGTTTTGAATTTTTGTCTTGG - Intergenic
945012207 2:205477628-205477650 TCTTTGTTGCTCTTGTGTCTAGG + Intronic
945362602 2:208909449-208909471 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
945373685 2:209053119-209053141 TCTTTGTTGACTTTCTGCCTCGG - Intergenic
945754211 2:213826786-213826808 TCTTTGTTGATTTTCTGTCTGGG + Intronic
946573494 2:221049863-221049885 TCTTAATTGAATTTCTGCCTTGG + Intergenic
947008884 2:225543805-225543827 TGTTTGTTGACTTTCCGTCTGGG + Intronic
948067665 2:235093213-235093235 TGTTTGTTGTTTTTTTGTTTTGG - Intergenic
948245601 2:236481539-236481561 TCGTTTTTGATTTTCTGTTGGGG + Intronic
948554612 2:238799511-238799533 CCTTTCTTGCTTTTTTGTCTTGG - Intergenic
948690129 2:239696784-239696806 ACTTTGCTCATTGTCTGTCTTGG + Intergenic
1169650729 20:7864472-7864494 TTTTTGTTGTGTTTCTCTCTTGG - Intergenic
1170267793 20:14486941-14486963 TCTTTTTTAATTTTGTGTTTGGG - Intronic
1170402187 20:15999520-15999542 TCTTTATTGATTTTCTTTCTGGG + Intronic
1170708930 20:18772061-18772083 TCTTTGCAGATTTTCTGTCTGGG + Intergenic
1171098377 20:22355640-22355662 TCTTTGTTATTTTTCTGTGGTGG - Intergenic
1171561030 20:26126188-26126210 TCTTTGTTCATTTTCTGTTGGGG - Intergenic
1172677795 20:36686879-36686901 TGTTTGTTTGTTTTCTTTCTGGG + Intronic
1172708263 20:36899476-36899498 TATTTGTTGAATTTCAATCTAGG - Intronic
1172802598 20:37587657-37587679 TCCTTGTTGATCTTCTGCATAGG - Intergenic
1173321924 20:41996055-41996077 TCTTTGTTGATTTTATGTCTAGG + Intergenic
1173715583 20:45201185-45201207 TCTTTGCAGATTTTCTGTCTGGG + Intergenic
1175607885 20:60326326-60326348 TCTTTGGTAATATTCAGTCTTGG + Intergenic
1176360532 21:5992833-5992855 TCCTTGTTAATTTTATGTCTAGG + Intergenic
1176361260 21:5998582-5998604 TTTTTGTGGATTTTGTCTCTAGG - Intergenic
1176650181 21:9538851-9538873 TCTTTGTTTATTTTCTGTTGGGG + Intergenic
1176880752 21:14189997-14190019 TTTTTCTTAATTTTCTTTCTAGG + Intronic
1176899939 21:14428366-14428388 CCCTTATTGATTTTCTGTCTGGG - Intergenic
1176933139 21:14837602-14837624 TTGTTGTTGTTTTTCTGGCTGGG - Intergenic
1177000641 21:15607902-15607924 TTTTCTTTGATTTTCTGTTTTGG - Intergenic
1177043727 21:16145075-16145097 TCTTTGTGAATTTTCAGTCTTGG + Intergenic
1177085640 21:16699912-16699934 TCTTTTTTTATTTTCTTTTTTGG + Intergenic
1177170785 21:17653558-17653580 CCTTTTTTGTTTTTCTGTTTTGG + Intergenic
1177215825 21:18127375-18127397 AAATGGTTGATTTTCTGTCTGGG + Intronic
1177264603 21:18765893-18765915 GCTTCTTTGATTTTCAGTCTAGG + Intergenic
1177294558 21:19158212-19158234 TTTATGTTGGTTTTCTCTCTTGG + Intergenic
1177496002 21:21893528-21893550 TCCTTTATTATTTTCTGTCTGGG + Intergenic
1177544433 21:22537690-22537712 TTTTTTTTTATTTTCTGCCTTGG - Intergenic
1177711268 21:24778094-24778116 TCTCTGTTGATTTTTTCTTTTGG + Intergenic
1177846373 21:26292462-26292484 TTTATGTTGATTTTGTGTGTCGG + Intergenic
1177872956 21:26595562-26595584 CATTTGTTCATTTTCTTTCTGGG + Intergenic
1177912478 21:27049809-27049831 TCCTTGTTAATTTTCTGTCTGGG + Intergenic
1178034098 21:28561544-28561566 TCTTTGTTAGTATTCTGCCTTGG - Intergenic
1178194245 21:30324883-30324905 TCCTTTTTGATCTTCTGTCTGGG + Intergenic
1178818517 21:35953684-35953706 GCTTTGTTGATTGTCTGCTTTGG - Intronic
1179083934 21:38200320-38200342 TATTTGCTGACCTTCTGTCTTGG + Intronic
1179255818 21:39714359-39714381 TTGTTTTTGATTTACTGTCTTGG + Intergenic
1179327931 21:40367931-40367953 TGTTTGTTCATTTTTTGTTTTGG - Intronic
1179762258 21:43539968-43539990 TTTTTGTGGATTTTGTCTCTAGG + Intronic
1179762986 21:43545717-43545739 TCCTTGTTAATTTTATGTCTAGG - Intronic
1179773830 21:43646296-43646318 TCCTAGTTGATTTTTTGGCTGGG - Intronic
1179939977 21:44631235-44631257 TCTTTATTGATATTCTCTCTTGG - Intronic
1180305686 22:11121797-11121819 TCTTTGTTGTTGTTCTGTTTTGG - Intergenic
1180544205 22:16483980-16484002 TCTTTGTTGTTGTTCTGTTTTGG - Intergenic
1181515523 22:23409472-23409494 GCTCTGTTGATTTTCTGGCTTGG + Intergenic
1181824840 22:25506802-25506824 TCTTTATTTTTTTTCTGTCTTGG + Intergenic
1182164624 22:28161042-28161064 TCACTGCTGATTTTCTGTCAGGG + Intronic
1182207917 22:28647347-28647369 TCTTTGTTGCTTTTGCTTCTGGG - Intronic
1182672842 22:32011840-32011862 TCCTTATTGATTTTCTGTCTGGG + Intergenic
949181656 3:1138481-1138503 TCTTTATTTATTTACTGTTTTGG + Intronic
950275567 3:11657410-11657432 TCTTTTTTATTTTTTTGTCTTGG - Intronic
950960619 3:17102207-17102229 TCTTTGTTGATTTTTTGTCTGGG - Intergenic
950963779 3:17131845-17131867 CCTTTTCTGTTTTTCTGTCTTGG - Intergenic
951005978 3:17616439-17616461 TCTTTGTTAACCTTCTGTCTCGG + Intronic
951017580 3:17746909-17746931 TCTATGTGCATTCTCTGTCTTGG + Intronic
951171845 3:19551604-19551626 TCTTTGTTGATTTTCTATCTGGG + Intergenic
951206705 3:19933498-19933520 TCTTTTTCCATTTCCTGTCTTGG + Exonic
951250130 3:20384646-20384668 CCTTATTTGCTTTTCTGTCTAGG + Intergenic
951255259 3:20441599-20441621 TCTTTATTGGTTTTCTGTCTGGG - Intergenic
951310019 3:21114203-21114225 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
951380076 3:21972837-21972859 TCTTAGTAGATTGTGTGTCTAGG - Intronic
951637447 3:24795169-24795191 ACTTTGCTGATTTTCTTTCAGGG + Intergenic
951860678 3:27248902-27248924 CCTTTACTGATTTTCTATCTGGG + Intronic
951955475 3:28248612-28248634 TCTTTTTTAATTTTTTGTTTGGG + Intronic
952066186 3:29574108-29574130 TCTTTGTTGAGTTTCTATCTGGG + Intronic
952629629 3:35450721-35450743 TCTTGGATTGTTTTCTGTCTGGG - Intergenic
953021134 3:39114088-39114110 TTTTTGTTGTTGTTCTGTCAAGG - Intronic
953147971 3:40296198-40296220 TTTTGGTTGATCTTCTGACTTGG - Intergenic
953309171 3:41860274-41860296 TCTTTGTTGATTTTCTGTCTGGG + Intronic
953534898 3:43769935-43769957 TCCTTGATGCTTTTCTGTCCTGG - Intergenic
954471829 3:50704321-50704343 TCTTTGTTTATTTTCTCTCTAGG + Intronic
954929700 3:54270779-54270801 TCTTTGTTGGCTTTCAGTCCAGG + Intronic
955514435 3:59712791-59712813 TCTTAGGTGATTTTCTCTCAAGG - Intergenic
955824468 3:62930585-62930607 TCTTTGTAAATTTTTTGTTTAGG - Intergenic
956024501 3:64968643-64968665 TCTTTATTGATATTCTTTATTGG + Intergenic
956298587 3:67742991-67743013 TCCTTGCTGAGTTTCTGTCTAGG + Intergenic
956371600 3:68569588-68569610 TTCTTGTTGATTTTCTGTCTGGG + Intergenic
956476382 3:69624733-69624755 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
956891689 3:73620354-73620376 TCTTTTTTGCTTTTCTTTCTGGG - Intronic
957098268 3:75798235-75798257 AGTCTGATGATTTTCTGTCTTGG + Intergenic
957249053 3:77749629-77749651 TCCTTGCTGACTTTCTTTCTGGG + Intergenic
957458005 3:80478706-80478728 TCTTTGTTCATTTTCTGTCTGGG + Intergenic
957485752 3:80860394-80860416 TCCTTGTTGATTTTCCATCTGGG - Intergenic
957858646 3:85913909-85913931 TGTTTGTTGTTTTTATTTCTAGG + Intronic
958472891 3:94543725-94543747 TCATTGTAGATTTTCTATGTTGG + Intergenic
958617795 3:96517686-96517708 TCTTTGTTGATTTTTTGTCTGGG - Intergenic
958630945 3:96682947-96682969 TTTTTGTTGATTTTCTGTCTGGG + Intergenic
958631950 3:96696589-96696611 TCTTTGTTTATTTTCTGTCTGGG + Intergenic
958638252 3:96773539-96773561 AATTTGTTGATTTTCTGCCTAGG - Intergenic
958639924 3:96792972-96792994 TGTTTGGTGGTTTTCTGTCATGG + Intergenic
958789988 3:98641251-98641273 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
958840213 3:99194414-99194436 CCTTTGTTGATTTTCTGCCTGGG - Intergenic
958951456 3:100421270-100421292 TCTTTCTTGATTCTCTTGCTGGG + Intronic
959191382 3:103115910-103115932 TATTTGTTGATTTTCTGTCCAGG - Intergenic
959328495 3:104970797-104970819 ACCTTGTTGATTTTCTGTCTGGG + Intergenic
959464114 3:106664950-106664972 TCTTGGTTGATTTTCTTCCTAGG - Intergenic
959591246 3:108084326-108084348 TCTTTCTTGCTCTTCTCTCTTGG + Intronic
959613556 3:108321817-108321839 TCTGTGTCTATTTACTGTCTAGG + Intronic
959766319 3:110033966-110033988 TCTTTGCTAATTTTCTGTCTAGG + Intergenic
960020140 3:112940884-112940906 TTTGGGTTGATTTCCTGTCTTGG - Intronic
960521165 3:118657572-118657594 TGTTTGTTGACATTCTGTCTGGG + Intergenic
960539463 3:118847645-118847667 TCTTAGTTGTTTTAATGTCTTGG - Intergenic
961861892 3:129923281-129923303 TCTTTTTTCTTTTTTTGTCTTGG - Intergenic
961956122 3:130805567-130805589 TGTTTGTTGGTTTTCCTTCTAGG - Intergenic
961964101 3:130884549-130884571 TGTTTGTTGATTTTCTGTCTAGG + Intronic
961967647 3:130923007-130923029 TCTTTCTTGACTTTCTGTCTTGG + Intronic
961985750 3:131131673-131131695 TTTTTGTTGATATTCTCTATTGG + Intronic
962201978 3:133407889-133407911 TCATTTTTGATTTTATATCTAGG - Intronic
962497670 3:135958545-135958567 TCTTTGTTGATTTTCTGTCTAGG + Intergenic
962545340 3:136428748-136428770 TCTTTGATGATTTTCTTGATTGG - Intronic
962621899 3:137188585-137188607 TCTTTTTTGGTTTTATGTTTTGG + Intergenic
963330794 3:143912938-143912960 TCTTTGTTGATTTTCTATCTGGG - Intergenic
963371079 3:144401060-144401082 TCTTTGTTGATTGTTTGTCTGGG + Intergenic
963459023 3:145582842-145582864 TTTTTGTTGATTATATATCTAGG - Intergenic
963657122 3:148068007-148068029 TCCTTGTTGATATTTTATCTTGG - Intergenic
963758535 3:149260573-149260595 TCTTTTTTTTTTTTCTGACTGGG - Intergenic
963923522 3:150928026-150928048 TTTTTGTTCATTTTCTGAATGGG - Exonic
964062612 3:152541981-152542003 TGTTTGTTAATTTTCTGCCTTGG - Intergenic
964379074 3:156079115-156079137 TCTTTGCTGATTTTCTGTCTGGG + Intronic
964558876 3:157971461-157971483 TATTTGTTTATCTTATGTCTTGG - Intergenic
964825448 3:160822046-160822068 TCTTTTTTAATTTTCTTTTTAGG - Intronic
964961283 3:162430167-162430189 TCTTTGCTGGTTTTCTCTCTGGG - Intergenic
965278192 3:166715168-166715190 TCCTTTTTGAGTTACTGTCTGGG - Intergenic
965451287 3:168841434-168841456 TCTGTATTGATGTTCTGTATTGG + Intergenic
965952932 3:174332768-174332790 TCTATGTTGATTTCATATCTTGG - Intergenic
966099572 3:176250270-176250292 TCTTTTTTGTTTTTCTATTTAGG - Intergenic
966152590 3:176880386-176880408 TCTTTGTTAATTTTCTGCCTTGG - Intergenic
966276954 3:178184594-178184616 AAGTTGTAGATTTTCTGTCTTGG - Intergenic
966365157 3:179177670-179177692 TTTTTGTTAATTTTCTGAATGGG - Intronic
966391046 3:179452454-179452476 TCTTTGTGGAGTTTCTGTGCCGG + Intergenic
966977691 3:185100139-185100161 TCTTTTTTAATTTTTTGCCTCGG - Intronic
967401214 3:189063357-189063379 TATTTTCTGATTTACTGTCTAGG - Intronic
967449261 3:189604522-189604544 CCTCTGTAGATTTTCTTTCTTGG + Intergenic
967507739 3:190271989-190272011 TCTTTGCTGATTCCCAGTCTAGG - Intergenic
967540986 3:190667544-190667566 TCTTTCTTGATTTGGTGTCACGG + Intergenic
967544570 3:190709569-190709591 GCTTTCTTGATTTATTGTCTTGG + Intergenic
967837136 3:193974347-193974369 AGTTTTTTAATTTTCTGTCTGGG + Intergenic
968253209 3:197242380-197242402 TCTTTGTTTATTTTCTGTCTGGG - Intronic
968426242 4:525287-525309 TCTTAGTTATTTTTCTGTCCTGG - Intronic
968716393 4:2162799-2162821 TGTTTGTGGATTTTCTATCTTGG + Intronic
969473647 4:7407220-7407242 CCTTTGTTGATCTTCTGTCTGGG + Intronic
969921581 4:10545347-10545369 TCTTTCTTGGGTTTCAGTCTTGG - Intronic
969997909 4:11333479-11333501 TCTTTGTGTATTTTTTTTCTAGG - Intergenic
970185875 4:13452820-13452842 TATTTGTTGATTTTCTGTTTAGG + Intronic
970475697 4:16420629-16420651 TCTTTGTTGATTTTCTGTCTTGG + Intergenic
970530689 4:16979469-16979491 TTTTTGGGGATTTTCTGTGTAGG - Intergenic
971105185 4:23516885-23516907 TCTCTGTTGAGTTTCTGTCTGGG + Intergenic
971114088 4:23622989-23623011 TCTTTGTTAGTTTTCTGACTTGG - Intergenic
971692591 4:29856663-29856685 TCTTTGCTTCTTTGCTGTCTTGG - Intergenic
971729783 4:30362309-30362331 TCATTGTTTATTTTCTGTCTTGG - Intergenic
971807907 4:31384402-31384424 TTTGTTTTGTTTTTCTGTCTCGG - Intergenic
972183460 4:36498429-36498451 TCTTTGTTGTTGTAGTGTCTAGG + Intergenic
972294359 4:37722387-37722409 TGTTTGGAGATTATCTGTCTAGG - Intergenic
972928676 4:44043640-44043662 TCTTTGTTGAATTTATGTTTGGG - Intergenic
972955298 4:44382175-44382197 TGTTTATTGATTTTCTGTCTAGG - Intronic
973054101 4:45632314-45632336 TCTTTGTTGATTTTCTGTCTAGG - Intergenic
973853021 4:54980313-54980335 TTATTGTTGATTTTCTCTCTGGG - Intergenic
973987153 4:56365309-56365331 TCCTTGTTAACTTTCTGTCTCGG - Intronic
974166616 4:58212793-58212815 TCTTTGAGGAGTTTGTGTCTAGG + Intergenic
974290925 4:59929111-59929133 TCTTTGTTGATTTTCAGACTGGG - Intergenic
974677625 4:65114566-65114588 TCTTTGCTGATTTTCTGTCTGGG - Intergenic
974703673 4:65484073-65484095 TCTTTGTTGATTCTCTTTAGTGG - Intronic
974821269 4:67069377-67069399 TCTTCTTTGATTTTCTTTCCCGG - Intergenic
974844630 4:67336589-67336611 TCTTTTCTGTTTTTCTGTTTTGG - Intergenic
975030851 4:69614130-69614152 TGTATGTTGATTTTGTGTCCTGG - Intronic
975082028 4:70292765-70292787 TCTTGGTAGATTGTATGTCTAGG + Intergenic
975315972 4:72953528-72953550 TTTTTAATGATTTTCTTTCTTGG - Intergenic
975656351 4:76644831-76644853 TTTTTGTTCCTTTTGTGTCTTGG + Intronic
975668645 4:76757862-76757884 TCTTTGTGGATTGACAGTCTGGG + Intronic
975886888 4:78976829-78976851 TCATTGTTGATCATCTGGCTTGG + Intergenic
975898948 4:79127280-79127302 TCTTTGTAAATTTTCTGCTTGGG + Intergenic
975918285 4:79351006-79351028 TCTATGTTAATTTTCTGTCTAGG - Intergenic
975920615 4:79381779-79381801 TCTATGTTGATTTTCTGTCTAGG - Intergenic
975947204 4:79721578-79721600 TCTATGTTAATTTTTTTTCTGGG - Intergenic
976029771 4:80738279-80738301 TCTTTGTTGATTTTCTGTCTAGG + Intronic
976041343 4:80888562-80888584 TCCTTGTTGATTTTCTGCCTGGG - Intronic
976136274 4:81939667-81939689 TCTTTACTGATTTTCTGAGTGGG - Intronic
976352096 4:84071280-84071302 TGTCTGTTCATTTCCTGTCTGGG - Intergenic
976519935 4:86014958-86014980 TCTTTACTGATTTTCTTTCTCGG - Intergenic
976736057 4:88311390-88311412 TCCTTATTGAGTTTCTGTCTAGG + Intergenic
976941904 4:90712687-90712709 TTTTTGTTAATTTTCTATCTCGG + Intronic
976948236 4:90797037-90797059 TCTTTGCTTATTTTCTGTCTTGG + Intronic
977045628 4:92065283-92065305 TCTTTGTTGAGTTTCTCATTTGG - Intergenic
977045711 4:92066511-92066533 TCTTTGTTGAATTTCTCATTTGG + Intergenic
977521951 4:98095761-98095783 TCTTTGTTGATTTTCTCTTTGGG - Intronic
977541382 4:98322360-98322382 TCCTTGTTGACTTTCTGTCTCGG - Intronic
977567464 4:98595987-98596009 TCCTTGTTGACTTTCTGTCTCGG + Intronic
977642574 4:99373783-99373805 GCTTTTTTGGTTTTCTGTTTGGG + Intergenic
977773386 4:100886869-100886891 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
978047414 4:104148039-104148061 TCTTTTTTTAATTTGTGTCTTGG + Intergenic
978158292 4:105514808-105514830 TCTTTGTTGACTTTCTTTCTTGG + Intergenic
978368262 4:108005052-108005074 TCTTTCTTTATTTTCTGTATTGG + Intronic
978967967 4:114765838-114765860 CATTTTTTGATTTTCTGTCTTGG + Intergenic
978971398 4:114811472-114811494 TGTTTGTTAATTGTCTTTCTAGG - Intergenic
979020537 4:115491320-115491342 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
979213037 4:118129734-118129756 TTTTTGTTGAGTTCCTGTCTGGG + Intronic
979255512 4:118603937-118603959 TCTTTGGAGATTCTCTGTATAGG + Intergenic
979332828 4:119436580-119436602 TCTTTGGAGATTCTCTGTATAGG - Intergenic
979348829 4:119622291-119622313 TCTTTGTATATTTTCAGTATAGG + Intronic
979364987 4:119811080-119811102 TCCTTATTGACTTTCTGTCTGGG + Intergenic
979374121 4:119924445-119924467 TTTTGGTTGATTTCATGTCTTGG + Intergenic
979383042 4:120031010-120031032 TCTTGCTTGATTGTCTTTCTAGG - Intergenic
979396977 4:120200641-120200663 TCTTTGTTCATTTTCCGTCTGGG - Intergenic
979473147 4:121124589-121124611 TCTTTCTTCTTTTTCTTTCTAGG - Intergenic
979772799 4:124550151-124550173 TCTTGGTTGATTGTGTTTCTTGG + Intergenic
979981377 4:127259682-127259704 TCTAGGTTGATTTTTTATCTTGG - Intergenic
979995631 4:127427415-127427437 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
980172163 4:129303037-129303059 TCTTTGTTTATTTTCTATCTGGG + Intergenic
980562166 4:134491492-134491514 TTCTTGTTGATTTTCTGTCTAGG - Intergenic
980864031 4:138532770-138532792 TCTTTGTTGTTTTTTTCTCTAGG - Intergenic
981837210 4:149067992-149068014 TCTTTTTTGACTTCCTGTCTGGG - Intergenic
982683042 4:158455688-158455710 TCTTTGTTGACTTTCTGTCATGG + Intronic
982828017 4:160024511-160024533 TCTCTGTTAATTTTCTGCCTGGG + Intergenic
982891010 4:160849980-160850002 TCTTTGCTGAATTTTTATCTAGG + Intergenic
982898933 4:160972960-160972982 TCTTTCTGGATTTTCTGTGTGGG - Intergenic
982993824 4:162316007-162316029 TCTTTATTGTTTTCCTGACTAGG + Intergenic
983041656 4:162935442-162935464 TCTTTGTTGATTTGGGGTCCAGG + Intergenic
983229436 4:165114264-165114286 TAGTTGTTCATTTTTTGTCTTGG + Intronic
983389176 4:167106070-167106092 TCTCTGTTGATTTTCTATCTGGG - Intronic
983758113 4:171367880-171367902 TCTTTGTAGATTTTATCACTTGG + Intergenic
983839230 4:172435747-172435769 TCTTCGGTGCTTTTCTTTCTAGG - Intronic
983845380 4:172511985-172512007 TCTTTGCAGACTTTCTGTGTTGG + Intronic
983850578 4:172575851-172575873 TTTTTGTTGATTTACAGTTTTGG + Intronic
984045127 4:174788070-174788092 ACTTTGTTTATTTTCTTTATTGG + Intronic
984343815 4:178493734-178493756 TCTGTATTGATATTCTGTCAAGG - Intergenic
984456067 4:179970742-179970764 TCTTTTTTTTTTTTCGGTCTAGG + Intergenic
984529423 4:180898470-180898492 TTTTTCTTTATTTTCTGTCTAGG + Intergenic
984587208 4:181578233-181578255 TCTTTGTTTGTTTTCCCTCTTGG + Intergenic
984722360 4:182986942-182986964 GCTTTGTTGATTCTCTATCTTGG - Intergenic
984741831 4:183172325-183172347 TCTTGGTTTATTCTCTGTTTTGG + Intronic
984838638 4:184047600-184047622 TCTTTGTTAATTTTATGTTTTGG + Intergenic
984914997 4:184714998-184715020 TCTCTGTTGTTGATCTGTCTTGG - Intronic
985076573 4:186221836-186221858 TCCTTGTTGATTTTCTGTCCAGG + Intronic
985140231 4:186832212-186832234 TCTGTGTTGATGTTCTGTGATGG - Intergenic
985375817 4:189337656-189337678 TCATTGTTGGTTTTCTGTTTAGG - Intergenic
985521347 5:375314-375336 TCAAACTTGATTTTCTGTCTGGG + Intronic
986217709 5:5736079-5736101 TCTTTGTTTGTTTCCTGCCTTGG + Intergenic
986905409 5:12489322-12489344 TTTTTGTTGATTTTCTGTATAGG - Intergenic
987673221 5:21041371-21041393 TCTTGATTGATTTTCTGTCCAGG - Intergenic
987878792 5:23714049-23714071 TAATTGTTGGTTTTCTGCCTGGG - Intergenic
988197342 5:28021635-28021657 TTTTTGTGGATTTTCTCTGTTGG + Intergenic
988627758 5:32896424-32896446 TCCTTGTTAATTTCCTCTCTGGG + Intergenic
988642231 5:33052817-33052839 TCCTTATTAATTTTCTGTCTGGG - Intergenic
989970434 5:50518267-50518289 TCTTTGTTGATTATCTGTCTGGG + Intergenic
989974570 5:50568685-50568707 TCTTTGTTGATTTTCTGTGTGGG - Intergenic
990015564 5:51057547-51057569 TCTTTGGTTCTTTTCTGTCAAGG + Intergenic
990120969 5:52450920-52450942 TCTTTGTTTAATTGCTTTCTTGG - Intergenic
990428973 5:55716332-55716354 TTTTTGTTGATCTTCTATCTGGG - Intronic
990585754 5:57209153-57209175 TGTGTGTTGATCTTCTATCTTGG + Intronic
990593208 5:57286850-57286872 TGTTTGTTGATTTTCTGTCTGGG - Intergenic
990854019 5:60242415-60242437 TCTTTGTTGATTTTCTATATGGG - Intronic
991107213 5:62858170-62858192 TCTTTGTTGAGTTTCTGTCTGGG + Intergenic
991153617 5:63401811-63401833 TTTTTTTTAATTTTCAGTCTTGG + Intergenic
991205656 5:64047251-64047273 TTTATGTTGATTTTGTGTCCTGG - Intergenic
991256096 5:64616844-64616866 TTTTTGTTGGGTTTCTATCTAGG - Intergenic
992453834 5:76897819-76897841 TGTATGTTGATTTTGTATCTTGG + Intronic
992504488 5:77373095-77373117 TCTTTTTTATTGTTCTGTCTAGG + Intronic
992933962 5:81681754-81681776 GCTTTGTTGATTTTCTCTGTTGG - Intronic
993178217 5:84516240-84516262 TCTTTGTTAATTTTCTGCCTTGG + Intergenic
993206815 5:84892448-84892470 TCTTTATTGATTTTCTGTCTGGG + Intergenic
993279972 5:85912838-85912860 TCTTTGGTAGTTTTCTGCCTTGG - Intergenic
993286867 5:86010450-86010472 TCTTTGTTAGTTTTCTGTCTTGG + Intergenic
993336224 5:86662570-86662592 TCTTTGTTAATTTTCTGTCTTGG + Intergenic
994278774 5:97874303-97874325 TGTTTGTTTATTTTCAGTGTGGG - Intergenic
994294164 5:98068795-98068817 TCTTTGTTGATTTTATGGGGTGG + Intergenic
994374868 5:99008016-99008038 TTTTTGTGGATTTTCTGCTTAGG - Intergenic
994636283 5:102347946-102347968 TCTTTGTTGACTTTCTGTCTAGG - Intergenic
994802164 5:104392604-104392626 TTTTTGTTGGTTTTGTGTGTTGG + Intergenic
994807145 5:104463367-104463389 TCTTTGTTGATTTTCTATCTAGG + Intergenic
995049905 5:107690879-107690901 TCTTTGATGATTTTCTGTCTGGG - Intergenic
995257392 5:110062723-110062745 TCTCTGTAGATCTTCTATCTAGG + Intergenic
995691622 5:114832159-114832181 TCTTTGTTAATTTTCTATCTTGG - Intergenic
995889963 5:116940155-116940177 GATTTGTTGACTTTCTTTCTAGG - Intergenic
996118622 5:119646620-119646642 CCTATGTGGTTTTTCTGTCTTGG + Intergenic
996138682 5:119877309-119877331 TTTTTCTTGACTTTCTGTGTTGG + Intergenic
996192404 5:120562027-120562049 TCTTTGATGAGTTTCTGTCTGGG + Intronic
996259559 5:121449119-121449141 CCAGTGTTTATTTTCTGTCTGGG - Intergenic
996275615 5:121662282-121662304 TCTTTGTTGATTTAAAGTCTAGG - Intergenic
996459788 5:123728297-123728319 TCTTTGTTGAGTTTCTGTCTGGG - Intergenic
996615787 5:125440131-125440153 TTTTTTTTGATTTTCTGGGTTGG + Intergenic
996669395 5:126099646-126099668 TCCTTCTTGATGTTTTGTCTTGG + Intergenic
996807231 5:127469426-127469448 TACTTGTTCATTTTATGTCTAGG + Intergenic
996827050 5:127695797-127695819 TATTTGTTAATTGTCTGTTTTGG + Intergenic
996856036 5:128008538-128008560 TTTCTGTTGTTTTTCTGTATGGG - Intergenic
996953949 5:129161589-129161611 TCTTTGTTAATTTTCTCCCTTGG + Intergenic
997180306 5:131821544-131821566 TCTTTGTTGATTTTCTGTCTGGG + Intronic
997199106 5:131999032-131999054 TCTTTGATGATTTGGTGGCTGGG - Intronic
997209343 5:132068336-132068358 TCTGTTTTGGTTTTCTGTTTTGG - Intergenic
997609356 5:135203556-135203578 TCATGGTTGATTTTCTTTGTGGG + Intronic
997913190 5:137896710-137896732 CCTCTATTGTTTTTCTGTCTTGG + Intronic
997926798 5:138037799-138037821 TCTTTTTGGCTTTTCTGGCTAGG - Intronic
998182632 5:139956099-139956121 CATTTGTTTATTTTCTTTCTTGG - Intronic
998634321 5:143935689-143935711 TCTTTGTTGATTTTTTGTCTGGG - Intergenic
998697831 5:144660675-144660697 TCTTTCTTGACTTTAGGTCTGGG + Intergenic
998745668 5:145256645-145256667 TCTTTGTGTTTTTCCTGTCTGGG - Intergenic
999883712 5:155896140-155896162 TCTCTCTTGATTTTCAGTTTGGG + Intronic
1000417853 5:161002879-161002901 TCTTTGTTGACTTTCTCTCTAGG + Intergenic
1001174386 5:169452568-169452590 TCTTTGTTGAGATTTTTTCTAGG + Intergenic
1001373550 5:171231481-171231503 TTTTTGTTAATATTCAGTCTAGG + Intronic
1002121089 5:177005710-177005732 TCTTTATTGTTTTCCTGTCAAGG - Intronic
1002726326 5:181299527-181299549 TCTTTGGAGATTCTCTGTATAGG + Intergenic
1002802619 6:539713-539735 TTGTTGTTTATTTTCTTTCTTGG - Intronic
1003262182 6:4528266-4528288 TCTTTTTTGAGTTTTTGTCTGGG - Intergenic
1003299786 6:4868677-4868699 TCATTGCCGATTTTCTGTTTTGG + Intronic
1003665830 6:8110402-8110424 TCTTTGTTTGTTTTGTTTCTTGG - Intergenic
1003790518 6:9541692-9541714 TCTTTGTGGATTTACTGTCTTGG + Intergenic
1003932007 6:10933100-10933122 TCTATGTTGATTTTCAGTGAGGG + Intronic
1004793415 6:19053902-19053924 TCTTTGTTAGTTTTCTGCCTTGG - Intergenic
1005262543 6:24077158-24077180 TCTTTGTTGACTTTCTGCCTCGG + Intergenic
1005661047 6:27999924-27999946 TCTTTGTTTCTTTTTTGTCCTGG + Intergenic
1005963109 6:30707454-30707476 TTTGTGTTTACTTTCTGTCTAGG - Exonic
1006047881 6:31313354-31313376 TCTTTGTTGAATTTCAGTGTTGG - Intronic
1006500691 6:34457164-34457186 TCTTTGCTGCTTTTCAGTCTGGG - Intergenic
1006797928 6:36742886-36742908 TCTTCGTTCCTTTTCTCTCTGGG + Intronic
1006974421 6:38085144-38085166 TCTTTGTAGCCTTTATGTCTAGG + Intronic
1007062831 6:38957421-38957443 TCTTTATTGATTTTCTATCTGGG - Intronic
1007135621 6:39519139-39519161 TATTTATACATTTTCTGTCTCGG - Intronic
1007394960 6:41572365-41572387 TCTTTGTGTAGTGTCTGTCTCGG + Intronic
1007930163 6:45683565-45683587 ACTGTGGTGACTTTCTGTCTTGG - Intergenic
1007931173 6:45692189-45692211 TCTGTGTTGATGTACTGTTTTGG + Intergenic
1008312468 6:49993036-49993058 TTCTTTTTGATTTTCTGTCTGGG - Intergenic
1008351930 6:50501474-50501496 TGTTTGCTGATTTTCTGTGGTGG - Intergenic
1008490094 6:52077543-52077565 TCTTTGGTGATGTTCTCTCTGGG - Intronic
1008528400 6:52431749-52431771 TCTTTGTTGACTTTCTGTCTTGG + Intronic
1008707338 6:54178944-54178966 TCTCTGTTGATTTTCTGTCTGGG + Intronic
1009505446 6:64471396-64471418 TGTATATTGATTTTGTGTCTGGG - Intronic
1009745426 6:67807482-67807504 GTTTTGTTGATTTTCTCTATTGG - Intergenic
1009748361 6:67849616-67849638 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
1009840040 6:69058993-69059015 TTCTTATTAATTTTCTGTCTAGG + Intronic
1010045520 6:71438477-71438499 TCTTTGTTGATTTTCTGTCTTGG - Intergenic
1010268556 6:73894402-73894424 CCTTTGTTGATTTTCTTCCTGGG + Intergenic
1010314088 6:74424609-74424631 TCTGTGTTAATTTTCAGTCTTGG - Intergenic
1010333164 6:74647843-74647865 TTTTTCTTTATTTTCTGACTGGG - Intergenic
1010629906 6:78186824-78186846 TCTCTGTTGATTTTCTGTCTGGG + Intergenic
1010772747 6:79850585-79850607 TCTTTGTTAATTTTCTGTCTGGG - Intergenic
1010837235 6:80604089-80604111 TTCTTTGTGATTTTCTGTCTGGG + Intergenic
1010887947 6:81267122-81267144 TCCTTATTGATTTTCTGCCTGGG - Intergenic
1010888616 6:81275210-81275232 TCTTTATTCATTTTCAGGCTAGG - Intergenic
1010895197 6:81353488-81353510 GCACTGTTGATTTTATGTCTGGG - Intergenic
1010976047 6:82314494-82314516 TCTTTTTTCTTTGTCTGTCTTGG - Intergenic
1011151883 6:84283122-84283144 TCTTTGTTAGTTTTCTGTACTGG + Intergenic
1011242467 6:85287407-85287429 TCTTTATTGATTTTCTCTTTGGG - Intergenic
1011247115 6:85331259-85331281 TCTTTGTTTATTTTGGGTCATGG + Intergenic
1011295141 6:85818511-85818533 TCCTTGTTAACTTTCTGTCTCGG - Intergenic
1011914377 6:92485366-92485388 TCTTCGTTGAATATTTGTCTGGG + Intergenic
1012303182 6:97615790-97615812 TCATTGTTGATTTTGTGTTTGGG + Intergenic
1012580956 6:100870097-100870119 TCTTTATTGATTTTTTATTTTGG - Intronic
1012756447 6:103238065-103238087 TCTTTGTTGATGTTCTACCTTGG - Intergenic
1012786426 6:103634043-103634065 TCTCTGTTGACTTTCTGTCTAGG - Intergenic
1013187371 6:107771680-107771702 TCTGTGTTGAGGTTCTGTTTGGG + Intronic
1013459400 6:110360308-110360330 CCTCTGTTGAGTTTCTCTCTGGG + Intergenic
1013571665 6:111433227-111433249 ATTTTGTTGATCTTCTGTATTGG - Intronic
1014186629 6:118442279-118442301 TCTTTGTTGAGTTTCTGTCTGGG + Intergenic
1014229360 6:118885687-118885709 TCTGTGTTGTTTTTCTTTATGGG - Intronic
1015028137 6:128561946-128561968 TCTTTGTTGGTCTTCTGACCTGG - Intergenic
1015052594 6:128860556-128860578 TCTTTGTTTATTTTCTTTTTTGG + Intergenic
1015367994 6:132418663-132418685 TCTCTGTTTCTTTTGTGTCTGGG - Intergenic
1015415839 6:132947438-132947460 ACATTGTTGATTTTCTGTGTAGG + Intergenic
1015907556 6:138132745-138132767 TCTTTGTTGATTTTCTGTTGGGG + Intergenic
1016484832 6:144526232-144526254 TCTTTGTCGACTTTCTGTCTGGG + Intronic
1016541760 6:145173670-145173692 TTCTTGTTGGTTTTCTTTCTGGG - Intergenic
1016660502 6:146572764-146572786 TCGTAGTTGATTTTTTGTCTAGG - Intergenic
1016921266 6:149296426-149296448 TCTTTCTTGCTTTTCTCTGTGGG + Intronic
1016961522 6:149677181-149677203 CCTGTGTTGATTCTCTGTGTAGG - Intronic
1017623473 6:156324273-156324295 TCACTATTGATTTTCTCTCTAGG + Intergenic
1017802136 6:157906786-157906808 TGGTGGTAGATTTTCTGTCTAGG + Intronic
1017858422 6:158372331-158372353 GCTTTTCTGATTTTCTGCCTTGG - Intronic
1017925315 6:158906867-158906889 TCTATGTTGATTTACTATTTTGG - Intronic
1018244184 6:161806049-161806071 TCTTTTTTGATTTTGCTTCTGGG - Intronic
1018353055 6:162982853-162982875 TCTTTGTTGACTGTCTGTCTTGG + Intronic
1018506730 6:164478848-164478870 TCTTTTTAGGTTTTCTGGCTAGG + Intergenic
1018515605 6:164576882-164576904 TCTTGGTTAATTTTCTGTCTTGG - Intergenic
1018636737 6:165867618-165867640 TCTTTATTGATTTTCTGTCTAGG - Intronic
1018697672 6:166403090-166403112 TCTCTGTGGATTTGCTGTCCTGG + Intergenic
1019044655 6:169134818-169134840 TCTTTGTTGATTTTCTATCTGGG - Intergenic
1019850747 7:3554050-3554072 TCCTTGCTGATTTCCTGTCTAGG - Intronic
1020103699 7:5410499-5410521 TCTTTTTGCATTTACTGTCTTGG - Intronic
1020332153 7:7030294-7030316 TCTTTGTTGGCTTTCTGTCTTGG + Intergenic
1020422799 7:8028052-8028074 TCCTTGCTGATTTTCTGTCTAGG - Intronic
1020573304 7:9893469-9893491 AATTTGTTGATTTTCTGTGTAGG - Intergenic
1020574590 7:9910294-9910316 TCTTTGTTGATCTTCTATCTGGG + Intergenic
1020664823 7:11026629-11026651 GCTGTGTTGTTTTTCTGTATGGG + Intronic
1020687773 7:11316803-11316825 TCTTTATTTTTTTTTTGTCTTGG + Intergenic
1020714126 7:11648437-11648459 TTTTTGTTGTTGTTCTGTGTGGG + Intronic
1020915555 7:14187971-14187993 TCTTTGTTGAATTTCTCATTCGG - Intronic
1021280140 7:18707103-18707125 TCTTTGTGGCTTTTCTTCCTGGG - Intronic
1021282546 7:18738719-18738741 TATTTGATGATTATGTGTCTTGG + Intronic
1021326659 7:19279000-19279022 TGTATGTTCATTTTCTTTCTTGG + Intergenic
1021335923 7:19402455-19402477 GCTTTGTTGAGTTTTGGTCTGGG - Intergenic
1021843030 7:24737411-24737433 TCTTGGTAGGTTTTGTGTCTAGG - Intronic
1021864219 7:24938857-24938879 TCTTTTTTTTTTTTCTTTCTTGG - Intronic
1022053095 7:26699359-26699381 GCTTTCTTGAATGTCTGTCTTGG - Intronic
1022152371 7:27621312-27621334 TTTTTCTTGACTTCCTGTCTAGG - Intronic
1022541711 7:31143173-31143195 TCTTTATTGACTTTCTGTCTGGG + Intergenic
1022749582 7:33210433-33210455 TTCTTGTTGAGTTCCTGTCTAGG + Intronic
1022934147 7:35154391-35154413 TCCTTGTTAACTTTCTGTCTCGG - Intergenic
1023265951 7:38405813-38405835 TCTGTGTTAGTTTTCTGCCTTGG - Intronic
1023621404 7:42077096-42077118 TCTTTCTTGCTTTCGTGTCTGGG - Intronic
1023808729 7:43894170-43894192 GCTTTGTTGATTTTCTGCCTAGG - Intronic
1024021095 7:45371212-45371234 TTTTTATTGATTTTCTGTCATGG + Intergenic
1024071206 7:45787081-45787103 TCTTTGGAGATTCTCTGTATAGG + Intergenic
1024367090 7:48533541-48533563 TCTTTGTTGACTTTCTGTCTTGG + Intronic
1024404906 7:48967761-48967783 TTTTTGTTGGTGTTCTGTGTGGG + Intergenic
1024433958 7:49326926-49326948 TCCTTGCTAATTTTCTGTATAGG - Intergenic
1024629034 7:51232129-51232151 TCTTTCCTGATTCTCTATCTGGG - Intronic
1025276799 7:57589145-57589167 TCTTTGTTTATTTTCTGATGGGG + Intergenic
1025591629 7:62867321-62867343 TCTTTCTTGTTTTTTTTTCTTGG - Intergenic
1025799987 7:64777053-64777075 TCTTTGTTGATTTTCTTTCTGGG + Intergenic
1026021507 7:66710796-66710818 TCTTTAAAGATTTTCTTTCTTGG + Intronic
1026066632 7:67080118-67080140 TCTTTACTGATTTTCTGTCTAGG + Intronic
1026208813 7:68283399-68283421 TCTTTGTTAATTTCCTGTCTAGG - Intergenic
1026287407 7:68975420-68975442 TTTTTGTGGATTTTTTTTCTGGG + Intergenic
1026420211 7:70227965-70227987 TTCTTGTTGGTTTTCTATCTAGG + Intronic
1026431453 7:70351445-70351467 ACTTGGTTGATTTCCTATCTTGG + Intronic
1026570568 7:71526168-71526190 TCTTTCTTCATTTTCATTCTTGG + Intronic
1026609956 7:71849405-71849427 TCTTTGTTCTTTTTCAATCTTGG + Intronic
1026710283 7:72732228-72732250 TCTTTACTGATTTTCTGTCTAGG - Intronic
1026966503 7:74443543-74443565 TCTTTCTTTCTTTTTTGTCTGGG - Intergenic
1027760242 7:82268786-82268808 GCTTTTTGGATTTACTGTCTTGG - Intronic
1027820312 7:83034128-83034150 TGTTTTCTGATTTTCTGTCATGG - Intronic
1027933881 7:84577126-84577148 ACATTGTTGATTTATTGTCTAGG - Intergenic
1027996365 7:85430155-85430177 TCTTACTTGAGTTTCTGTCTGGG - Intergenic
1028222518 7:88214128-88214150 TCTTTCTTGATTCTCTTACTGGG - Intronic
1028299291 7:89177654-89177676 TCTTTGTTGATTATCTGTCTAGG + Intronic
1028313237 7:89365711-89365733 TTTTTGGTGATAATCTGTCTTGG - Intergenic
1028508675 7:91597608-91597630 TGTTTGTTTGTTTTATGTCTTGG + Intergenic
1028514176 7:91658158-91658180 TCTGTTTTGCTTTTCTGTCCTGG + Intergenic
1028519230 7:91710954-91710976 TTTTTGTTGATTTTCTGTCTAGG - Intronic
1028643982 7:93074777-93074799 CCTGTGTTGATTTTCCATCTAGG + Intergenic
1030041233 7:105452291-105452313 ACTGTGTTGATTTTCTGTTACGG - Intronic
1030390969 7:108928565-108928587 TCTTTGTTAATTTTCTGTCTTGG + Intergenic
1030602332 7:111606729-111606751 TCCTTGTTGCTGTCCTGTCTGGG - Intergenic
1030685128 7:112478505-112478527 TATTTTTTTTTTTTCTGTCTGGG + Intronic
1031098753 7:117451912-117451934 TCTTTGTTGATTTTCTGTGTGGG - Intergenic
1031148020 7:118018723-118018745 TCTTTGTTGACTTTCTGCCTTGG - Intergenic
1031638846 7:124137426-124137448 TCTTTGTTGATTTTCTGTCTAGG + Intergenic
1031722195 7:125190321-125190343 TCTTTGTTGATTTTCTGTCTGGG - Intergenic
1031754095 7:125615905-125615927 TATTTGTTGATTTTCTGTATAGG + Intergenic
1031849035 7:126841542-126841564 TGCATGTTCATTTTCTGTCTTGG - Intronic
1031862512 7:126996869-126996891 ACATTGTTGATTTTCTGCCTGGG + Intronic
1032249694 7:130244661-130244683 TCTCTGTTAATTTTTTGCCTGGG + Intergenic
1032775381 7:135107766-135107788 TCTTTGTGAATTTTCTGCCTTGG + Intronic
1032775399 7:135107988-135108010 TCTTTGTTGATTTAAAGTCTTGG + Intronic
1032837844 7:135690385-135690407 TGCTTCTTGATTTTCTGACTGGG - Intronic
1032840491 7:135709671-135709693 TCTTTGTTGATTCTCTCACTTGG + Intronic
1033007454 7:137582526-137582548 TTGTTGTTGTTTTTCTCTCTAGG - Intronic
1033094295 7:138416628-138416650 CCTTTCTTGATTATCTTTCTTGG + Intergenic
1033493854 7:141873404-141873426 TCATTGTTCATTTTCTGTTTAGG + Intergenic
1033813357 7:145043936-145043958 TCTTGCTTGATTTTATATCTTGG + Intergenic
1033944074 7:146693136-146693158 TCTTTGTTACTATTCTCTCTTGG - Intronic
1034315112 7:150123695-150123717 TCTTTCTTTTTTTTCTCTCTAGG - Intergenic
1034780518 7:153876237-153876259 TCCTTATTGATTTTTTTTCTTGG - Intergenic
1035445568 7:158940085-158940107 TCTTTGTTGACTTTCTGTCTGGG - Intronic
1036409271 8:8483777-8483799 TCCTTTAAGATTTTCTGTCTGGG + Intergenic
1037068707 8:14616515-14616537 CATTTGATGATTTTCTGTCATGG - Intronic
1037255734 8:16950691-16950713 TCTTTGTCGAATTTCTGTCTGGG - Intergenic
1037299502 8:17435964-17435986 TCTTCTTTCATTTTCTTTCTGGG - Intergenic
1037366936 8:18132747-18132769 TCTTTATTATTTTTCTGTCTGGG - Intergenic
1037854750 8:22363462-22363484 GTTTTGTTGATTTTCTCTATTGG - Intergenic
1037950916 8:23018378-23018400 TGTTTGTTGATTTTTCGTTTCGG - Exonic
1038115547 8:24550919-24550941 TTTTTTTTGTTTTTCTGTTTTGG + Intergenic
1039171474 8:34751924-34751946 TCTTAGTTCATTTTAAGTCTTGG + Intergenic
1039295877 8:36153876-36153898 TCTTTGTTCTTTTTCTGTTGGGG + Intergenic
1039640935 8:39219997-39220019 TCTTTTTTAGTTTTCTGTCTTGG + Intronic
1039653378 8:39370214-39370236 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
1039800258 8:40948483-40948505 TAATTATTGATTTTCTGTCATGG - Intergenic
1039880347 8:41621674-41621696 GCTTTGTTGAATGTGTGTCTCGG + Exonic
1040750016 8:50693556-50693578 TCCTTATTAATTTTCTGTCTGGG - Intronic
1040820362 8:51549270-51549292 TCTTTGTGGACTTTCCGTCTTGG - Intronic
1040822350 8:51576111-51576133 TCTTGGGTGATTTTCTGTTTAGG - Intronic
1041038819 8:53824923-53824945 TCTCTGTATATTTTCTGTTTTGG - Intronic
1041127992 8:54665087-54665109 TCTTTGTTGAAATTCTCACTTGG + Intergenic
1041585995 8:59520039-59520061 TCTTTGATGACATTCTTTCTGGG + Intergenic
1041602223 8:59732753-59732775 TTCTTCTTGATTTTCTGTTTGGG - Intergenic
1041784143 8:61612665-61612687 ACTTTGTTTATTTTTAGTCTGGG - Intronic
1041900376 8:62976235-62976257 TCCTTGTTAATTTTCTATCTCGG + Intronic
1042000290 8:64115053-64115075 TCTCTGTTAATTTTCTGTTTAGG - Intergenic
1042234070 8:66590290-66590312 TGTTTGTTTATTTTTTGTTTGGG - Intronic
1042261370 8:66863302-66863324 TGTTTCTTGATTTTCTGTCTAGG - Intergenic
1042610965 8:70600788-70600810 GCTTTGTTGGTTTTTTTTCTGGG + Intronic
1042898700 8:73698747-73698769 TCTTTGTTGATTTTCTTTCTGGG - Intronic
1043200289 8:77361029-77361051 TCTTTGATGATGTTGTGTGTGGG - Intergenic
1043224338 8:77704095-77704117 TCTATGTTGATTTTGTTTCTGGG + Intergenic
1043600511 8:81931466-81931488 TCTTTGTTGATTTTCTGTATGGG - Intergenic
1043641431 8:82455241-82455263 TCTTTGCAGATTCTCTGTCTTGG - Intergenic
1043763507 8:84099773-84099795 TCTTAGTGGCTTTTCTCTCTGGG + Intergenic
1043797570 8:84563623-84563645 TCTTTGTTGTTTTTATGTGCAGG + Intronic
1043990913 8:86753141-86753163 TCAATGTTGATTTCCTGACTTGG - Intergenic
1044218415 8:89640546-89640568 TCTTTGTTGACTTTCTGTCTAGG - Intergenic
1044227245 8:89733390-89733412 TCCTTATTGATTTTATTTCTGGG - Intergenic
1044308270 8:90663412-90663434 TATTTGTTAGTTTTTTGTCTTGG + Intronic
1046084072 8:109410248-109410270 TTTTTGTTTATTTTGTGTATAGG + Intronic
1046113899 8:109762317-109762339 TCTTTGTTGATTTTCAGTCTGGG + Intergenic
1046136744 8:110037227-110037249 ACTTCGTTGATTTTCTGAGTGGG + Intergenic
1046154127 8:110264996-110265018 TCTTTGTTAATGTTCTTCCTAGG + Intergenic
1046215359 8:111138925-111138947 TTTTTGCTGATTTTCTCTCTGGG + Intergenic
1046251536 8:111638203-111638225 TCTTTGTTGATTTTCTTTCTGGG - Intergenic
1046550183 8:115706116-115706138 TCTTGTTTGATATTCTATCTAGG - Intronic
1046825228 8:118682763-118682785 TCTTTGCTGATATTCTGTTGAGG + Intergenic
1046940619 8:119927490-119927512 TCTGTGTTGTATTTCTTTCTAGG + Intronic
1047148043 8:122227956-122227978 TATTTGTTGACTTTCTGTCTTGG - Intergenic
1047152170 8:122275947-122275969 TCCTTGTTAATTTTCCGTCTCGG - Intergenic
1047187431 8:122646500-122646522 TCTCAGTTGAGTTTCTCTCTAGG - Intergenic
1047648030 8:126889428-126889450 TTTGTGTTTATTATCTGTCTTGG - Intergenic
1047869431 8:129066323-129066345 TCCTTCTTGAGTTTGTGTCTGGG - Intergenic
1047936202 8:129781810-129781832 TCCTTGTTGATTTTCTGTCTGGG - Intronic
1047937012 8:129791844-129791866 TCTTTCTTGGGTTTCTGTCTAGG + Intergenic
1048566484 8:135603954-135603976 TCTTTTTTGACCTTCTTTCTAGG + Intronic
1048646966 8:136432105-136432127 TGTTTGTTGATTTTCTGTCTGGG - Intergenic
1048680446 8:136835461-136835483 TCTATCTTGATTCTCTGTCCTGG + Intergenic
1048756583 8:137746273-137746295 TCTTTGTTGACTTTCTATCTGGG + Intergenic
1048909172 8:139118011-139118033 TCTTGATTTATTTTCTGTGTAGG + Intergenic
1050248438 9:3716622-3716644 TATTTGTTGATTTTCTGTCTGGG - Intergenic
1050400790 9:5251616-5251638 TCCTTATGGATTTTGTGTCTGGG - Intergenic
1050409107 9:5343037-5343059 TCTTTGTTAATTATCTGTTCAGG - Intergenic
1050438932 9:5639634-5639656 TCTTTGTTGAGTTTCTGTCTGGG + Intronic
1050440936 9:5663375-5663397 TATCTGTTAATTTTCTGTCTTGG + Intronic
1050466571 9:5931609-5931631 TCTTTATGTATTTTCAGTCTGGG + Intronic
1050778654 9:9301940-9301962 TGTTTGTTGATTTGCTATGTTGG + Intronic
1051047493 9:12892146-12892168 TCTTTGTTGATTTTCTGCCTGGG - Intergenic
1051816731 9:21117305-21117327 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
1051899324 9:22022206-22022228 TCTTGGTTAATTTTCTGTCTCGG + Intronic
1051920936 9:22263392-22263414 TCTTTGTTGAGTTTCTTTTTTGG + Intergenic
1051946755 9:22578685-22578707 TCTTTGTTAGTTTTCTGCCTAGG + Intergenic
1051953836 9:22665352-22665374 TCACTGTTGATTTTTTTTCTTGG + Intergenic
1051999566 9:23260515-23260537 TTTTTGGTGAGTTTCTATCTGGG - Intergenic
1052006450 9:23355494-23355516 TCTTTGTTGACTTTCTCTCTTGG + Intergenic
1052072782 9:24103429-24103451 TCCTTACTGATTTTCAGTCTAGG - Intergenic
1052181793 9:25537817-25537839 CCTTTGTTCTTTTTCTGTCTGGG + Intergenic
1052551096 9:29950423-29950445 TCTTTGTTAGTTTTCTGCCTTGG + Intergenic
1053622680 9:39836037-39836059 TGTTTTTTAATTTTCTGCCTTGG - Intergenic
1053882184 9:42607049-42607071 TGTTTTTTAATTTTCTGCCTTGG + Intergenic
1053890483 9:42687243-42687265 TGTTTTTTAATTTTCTGCCTTGG - Intergenic
1054221209 9:62414517-62414539 TGTTTTTTAATTTTCTGCCTTGG + Intergenic
1054229505 9:62494656-62494678 TGTTTTTTAATTTTCTGCCTTGG - Intergenic
1054971938 9:71098195-71098217 TTTTTGTTACTTTTCTGTTTGGG - Intronic
1055180910 9:73385762-73385784 TCCTTGTTGATTTTCTGTCTGGG + Intergenic
1055377704 9:75667917-75667939 TCTTCTTTTTTTTTCTGTCTTGG - Intergenic
1055886227 9:81066601-81066623 TCTTTGTGGATTTCCTGTCTGGG + Intergenic
1055911084 9:81352578-81352600 TCTTTGTTGATGATCTGTCTGGG - Intergenic
1056025784 9:82493875-82493897 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
1056309659 9:85326615-85326637 TCTCTGTTGACTTTCTGTCTTGG - Intergenic
1056436992 9:86584144-86584166 TATTTGTTGTTTTACTTTCTTGG - Intergenic
1056556253 9:87691219-87691241 TCTTTGTAAATTATCTGTCTAGG + Intronic
1056729371 9:89152013-89152035 TGTTTGATGATTCTCTTTCTAGG + Intronic
1056907181 9:90663365-90663387 TCTTTGTTAATTTTCTGTCTTGG + Intergenic
1057018442 9:91676423-91676445 CCTTTGCTGATCCTCTGTCTAGG + Intronic
1057970976 9:99557172-99557194 TCTTTGTTCTTTTGCGGTCTAGG - Intergenic
1058004328 9:99899358-99899380 TCCTTGTTGATTTTCTGTCTGGG - Intergenic
1058570747 9:106340273-106340295 TCTTTGTTGATTTATGATCTTGG + Intergenic
1058653056 9:107195126-107195148 TTTTTGTTGTTTTACTGTATTGG + Intergenic
1058726808 9:107812424-107812446 TCCTTGATGCTTTTCTATCTTGG + Intergenic
1059400114 9:114063878-114063900 TCTGTATTGATTTTCTCTCCTGG - Intronic
1059773269 9:117448083-117448105 TCTTTCTAGAGTTTCTCTCTTGG - Intergenic
1059844487 9:118258918-118258940 TCTTTGTTAATTTTATGTGTGGG + Intergenic
1060163250 9:121386647-121386669 TCTTAGTTAATTTTCTCTCCTGG + Intergenic
1060763950 9:126279891-126279913 TCTTTGCTGTTTTTCTGGGTTGG - Intergenic
1060983906 9:127808959-127808981 TTTTTTTTGGTTTTCTGTTTGGG + Intronic
1061770025 9:132912199-132912221 TCTTTGTTGATTTTCTTTTCTGG - Intronic
1062751457 9:138257173-138257195 TCTTTGGAGATTCTCTGTATAGG + Intergenic
1203627922 Un_KI270750v1:42408-42430 TCTTTGTTTATTTTCTGTTGGGG + Intergenic
1185951544 X:4440921-4440943 TCATTGTTGTTTTTGTTTCTGGG + Intergenic
1186870658 X:13768017-13768039 TATTTGTGTATTTTCTGTTTTGG + Intronic
1187594174 X:20753369-20753391 TCATTGTTGATTTTCTGTCTGGG + Intergenic
1187618474 X:21024751-21024773 TCTTTGGTGATTTAGTTTCTTGG + Intergenic
1187634238 X:21209784-21209806 TCTTTGCTGATTTTCTCTCTGGG - Intergenic
1187838598 X:23461075-23461097 TCTTTGTTGAATTTATGTCTGGG + Intergenic
1188068533 X:25691896-25691918 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1188389146 X:29598575-29598597 TATTTGGTGACTTTCTGTCTTGG + Intronic
1188417462 X:29953745-29953767 GCTGTGTTGATTTTCTGTTGGGG - Intronic
1188478614 X:30613475-30613497 TCTTGATTGATTTTCTTTTTGGG + Intergenic
1188598896 X:31936292-31936314 ACATTGTTGAATTTCTGTCAAGG + Intronic
1188743115 X:33810373-33810395 TCTTTCTTGTTTTTCTTTTTTGG + Intergenic
1188746109 X:33846627-33846649 TCTTTGTTGAATTTCTCTTTTGG + Intergenic
1188924277 X:36020383-36020405 TCTTTTTGGATTTTCTGTTTGGG + Intergenic
1189183392 X:39027349-39027371 TCTTTGTTGATTTTCCTTTCTGG + Intergenic
1189189019 X:39080638-39080660 TATTTCTTAATTTTCTGTCTCGG + Intergenic
1189406040 X:40724277-40724299 TCTCTGTTGAGTTTCTGTCTGGG - Intronic
1189509827 X:41651899-41651921 TATATGTTTATTGTCTGTCTAGG - Intronic
1189657702 X:43264026-43264048 TATTTGTTGATTTTCTGTCTGGG + Intergenic
1189822081 X:44879786-44879808 TGTTTGTTGATTGTGTTTCTTGG + Intronic
1189885171 X:45535821-45535843 TCTTTGTTGGTTTTCTGTCTGGG - Intergenic
1190556230 X:51638156-51638178 TCTTTATTTTTTTTCTCTCTAGG + Intergenic
1190584330 X:51922887-51922909 TCTTTCATGTTTTTCTGACTTGG - Intergenic
1190606466 X:52148686-52148708 TCCTTGTTAACTTTCTGTCTCGG + Intergenic
1190943238 X:55065097-55065119 TCTTTGCTGATTTTCTGTCCAGG + Intergenic
1191065681 X:56344522-56344544 TCCTTATTGATTTTCTATCTGGG + Intergenic
1191181777 X:57571745-57571767 TCCTTGTTATTTTTCTGTCTTGG - Intergenic
1191212032 X:57895053-57895075 TCTTCATTAATTTTCTGTCTGGG - Intergenic
1191222183 X:58001559-58001581 TCTTTGTTAATTTTCTGTCTGGG - Intergenic
1191598027 X:62969446-62969468 TCTTTGTTAATTTTCTTCCTCGG - Intergenic
1191728313 X:64305469-64305491 TCTTTATTAATTTTCTCTTTGGG + Intronic
1191746377 X:64493233-64493255 TCTTTGTTGAGTTTCTGTCTGGG - Intergenic
1191819892 X:65293793-65293815 TCTTTGTTCTTTGTCTTTCTTGG - Intergenic
1191913741 X:66179609-66179631 TCTTTGTTGACTTTCTGTCTTGG + Intronic
1191930164 X:66363818-66363840 TATTTGTTGAATTTATTTCTAGG + Intergenic
1191944995 X:66523865-66523887 TCTTTCTTGACTTTCTGTCTTGG + Intergenic
1191972300 X:66830072-66830094 TTTTTGTTGATTTTCTGTCTGGG - Intergenic
1191989313 X:67016778-67016800 AGTTTGTTGATTTTATATCTTGG - Intergenic
1192057975 X:67792467-67792489 TCTTTGTTTACTTTCTGTTCTGG + Intergenic
1192069813 X:67925598-67925620 TCTTTGTTGATCATCTGTCTGGG - Intergenic
1192088292 X:68124493-68124515 TCTTTGTTGATTTTCTGTCTGGG - Intronic
1192678028 X:73220462-73220484 TGTTTGTTGATTATCTGTCTAGG - Intergenic
1192685061 X:73295258-73295280 GCTTTGTTAATTTTCTGTCTTGG - Intergenic
1192711683 X:73597311-73597333 CCTTTGTCCATTTTCTCTCTAGG + Intronic
1192790429 X:74377106-74377128 TCCTTGTTGATTTTCTGTCTGGG + Intergenic
1192841427 X:74860348-74860370 TCTTTGTTCGTTTTTTGTTTGGG - Intronic
1192891376 X:75394813-75394835 ACTTTGTTGATTTTCTGTCTGGG - Intronic
1192921441 X:75711192-75711214 TCTTTGTTGACTTTCTGTTTTGG + Intergenic
1192936743 X:75868574-75868596 TCTTTGTTGATTTGAGGTCATGG + Intergenic
1192975231 X:76276305-76276327 GCTTTTTTGATTTTCTGTCAAGG + Intergenic
1192979233 X:76320701-76320723 TCTTTGTGAATTTTCTGTCCTGG + Intergenic
1192995592 X:76509033-76509055 TCTTTGTCAATTTTCTGCCTTGG + Intergenic
1193005206 X:76609464-76609486 TCTTTGTTGATTTTCTATTTGGG - Intergenic
1193090098 X:77484683-77484705 TCTTTGGTAGTTTTCTGCCTTGG - Intergenic
1193182548 X:78475396-78475418 TCTTTGCTAACTTTTTGTCTTGG + Intergenic
1193361143 X:80580411-80580433 TCTTTGTTGATTTTCTTCCTGGG + Intergenic
1193432403 X:81424563-81424585 TCTTTGATCATTTGCTGGCTGGG + Intergenic
1193442430 X:81559238-81559260 TCCTTGTTAATTTTCTGTCTAGG - Intergenic
1193497054 X:82227634-82227656 TATTTCTTTATTTTCTGCCTGGG + Intergenic
1193526889 X:82602176-82602198 TCTTTGTTGACTTTCTGTCTGGG + Intergenic
1193619252 X:83731290-83731312 TATTTATTTATTTTCTGTCTGGG + Intergenic
1193632061 X:83901662-83901684 TCTTTGTTGACTTTCTGGCCTGG - Intergenic
1193642695 X:84030728-84030750 TTTTTGTTGAGTTTCTGTCTGGG - Intergenic
1193689809 X:84627489-84627511 TCTTTGTCGACTTTCTCTCTTGG + Intergenic
1193703644 X:84793304-84793326 TCTTTGTTAATTTTCTCCCCCGG - Intergenic
1193757000 X:85420932-85420954 TTTATGTTGATTTTGTGTCTTGG + Intergenic
1193806250 X:85998353-85998375 TCGTTTTTTATGTTCTGTCTGGG - Intronic
1193867885 X:86759163-86759185 TATTTGTTCATTTTCTGTCTAGG + Intronic
1193986583 X:88249777-88249799 TTGTTGTTAATTTTCTGTCTAGG + Intergenic
1194028959 X:88788307-88788329 TCTTTGTTAATTTTCTGTTTTGG + Intergenic
1194228280 X:91289262-91289284 TCTTTGTTGATTTTCTAGTGGGG - Intergenic
1194237460 X:91401705-91401727 TCTTTGTTGACTTTCTGTCTTGG - Intergenic
1194338144 X:92674767-92674789 TCTTTGCTGATTTTCTGTCTGGG + Intergenic
1194457258 X:94120316-94120338 TCCTTGTTGATATTCTGCCTGGG + Intergenic
1194492077 X:94564079-94564101 TCTTTGCTGATATTCTATCTAGG + Intergenic
1194602439 X:95939268-95939290 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
1194635381 X:96340310-96340332 TCTTTGTTAATTTTCTGTCTCGG + Intergenic
1194636768 X:96354417-96354439 TCCTTGTTGATCTTATGTCTGGG - Intergenic
1194796149 X:98213600-98213622 TCTTTGTTGAGTTTCTGTTTGGG - Intergenic
1194841398 X:98748613-98748635 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1194877310 X:99205479-99205501 TCTTCATTGATTTTCTGTCAGGG + Intergenic
1194892035 X:99392038-99392060 TTTTTGTTGATTTTCTGTCTGGG + Intergenic
1194942041 X:100022572-100022594 TCTTTGTTGTCTTTCTGTCTGGG - Intergenic
1195015858 X:100780173-100780195 TCTGTCTTGATGATCTGTCTAGG + Intergenic
1195148065 X:102037805-102037827 TCCTTGTTAATTTTCTTTCTTGG - Intergenic
1195224879 X:102783028-102783050 TCTTTGTTAATTTTCTGTCTGGG + Intergenic
1195289877 X:103422096-103422118 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1195631886 X:107064821-107064843 TCCTGGTTTATCTTCTGTCTAGG + Intronic
1195731353 X:107971190-107971212 CCTTTGTTGTATTTCTGTTTGGG + Intergenic
1195824728 X:108986849-108986871 TCTTTGTTGATTTTCTGTGCAGG + Intergenic
1196087604 X:111702217-111702239 TCCTAATTGATTTTCTGTCTAGG + Intronic
1196214232 X:113032023-113032045 TCTTCGTTTATTTTATGTCTGGG + Intergenic
1196385314 X:115142256-115142278 TCTTTGATGATTTTCTGTCTGGG - Intronic
1196509008 X:116482940-116482962 TCTTTGTTGATTTTCTGACTGGG - Intergenic
1196509925 X:116497426-116497448 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
1196547419 X:116978722-116978744 TCTTAATTGATTTTCTGTCTAGG - Intergenic
1196550678 X:117020342-117020364 TCTTTTTTGATTTTCTGCCTCGG - Intergenic
1196620100 X:117811993-117812015 TCTTGGTTTATTTTCTGTCTGGG - Intergenic
1196766540 X:119250783-119250805 TTTTTGTTTATTGTCTGACTTGG + Intergenic
1196980330 X:121206334-121206356 TCTTAGTTGATTTTTTGTCTGGG + Intergenic
1196998632 X:121413297-121413319 TCTTCATTGATTTTCTGTCTGGG + Intergenic
1197102708 X:122675104-122675126 TCTTTGTTGACTTTCTATCTTGG - Intergenic
1197114949 X:122820487-122820509 TCTTTGTTAATTTTCTGTCTTGG - Intergenic
1197623272 X:128776165-128776187 TCTTTGTTGTGTTTTTATCTGGG + Intergenic
1197677365 X:129344840-129344862 TCTTTGCTGGTTTTCTGTCTTGG - Intergenic
1197898805 X:131345891-131345913 TCTTAGTAGATCTTCTGTATTGG - Intronic
1198008907 X:132530532-132530554 TCTTTGTTGACTTTCTGTCTTGG + Intergenic
1198055961 X:132995099-132995121 TTTCTGTTGATGTTCTTTCTGGG - Intergenic
1198293986 X:135266720-135266742 TCTTTGTTGATTTTCAGTCTGGG - Intronic
1198295135 X:135280034-135280056 TGCTTGTTAATTTTCTGTCTTGG + Intronic
1198381748 X:136090586-136090608 TCTTTGATTTTTTTCTTTCTTGG - Intergenic
1198552113 X:137756129-137756151 TCGTGGTTGCTTTTATGTCTAGG + Intergenic
1198567547 X:137920106-137920128 TCTTTGTTTAACTTCTGTTTTGG - Intergenic
1198629646 X:138621075-138621097 TCCCTATTGATTTTCTGTCTGGG - Intergenic
1198724538 X:139663714-139663736 TCTTTGTTGATTTTCTGGCTAGG + Intronic
1198971333 X:142283885-142283907 TGTTTTTTGTTTTTCTTTCTGGG - Intergenic
1199138730 X:144285457-144285479 TCTTTGTTGATTTTCTGTTTTGG + Intergenic
1199277760 X:145965688-145965710 TCTTTGTTGAGATTCTGTTTGGG - Intergenic
1199325271 X:146491673-146491695 TCTTTTCTGATTTTCTTTCTGGG - Intergenic
1199445547 X:147916539-147916561 TCTTTCTTGGTTTTCTTTTTTGG + Intronic
1200364087 X:155643024-155643046 TCTTTGTTGATTTTCTGTCTGGG + Intronic
1200365714 X:155660570-155660592 TCTTTGTTGATTTTCTGCCTCGG + Intronic
1200369735 X:155712239-155712261 TCTTTGTTGATTTTCTGTCTGGG + Intergenic
1200380277 X:155830089-155830111 TCTTTGTTAGTTTTCTGCATTGG - Intergenic
1200646547 Y:5791500-5791522 TCTTTGCTGATTTTCTGTCTGGG + Intergenic
1201371231 Y:13267057-13267079 TCCTTGTTAATTTTCTGTCTTGG + Intronic
1201768887 Y:17598576-17598598 TTTTTGTTAATTTTTTGTTTTGG + Intergenic
1201832667 Y:18307409-18307431 TTTTTGTTAATTTTTTGTTTTGG - Intergenic