ID: 1116766229 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:49073493-49073515 |
| Sequence | TTCTTTGTTGATTTTCTGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4006 | |||
| Summary | {0: 322, 1: 596, 2: 602, 3: 679, 4: 1807} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1116766229_1116766230 | 11 | Left | 1116766229 | 14:49073493-49073515 | CCAGACAGAAAATCAACAAAGAA | 0: 322 1: 596 2: 602 3: 679 4: 1807 |
||
| Right | 1116766230 | 14:49073527-49073549 | AATCTGCTCTATAGAACAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1116766229 | Original CRISPR | TTCTTTGTTGATTTTCTGTC TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||