ID: 1116766229

View in Genome Browser
Species Human (GRCh38)
Location 14:49073493-49073515
Sequence TTCTTTGTTGATTTTCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4006
Summary {0: 322, 1: 596, 2: 602, 3: 679, 4: 1807}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116766229_1116766230 11 Left 1116766229 14:49073493-49073515 CCAGACAGAAAATCAACAAAGAA 0: 322
1: 596
2: 602
3: 679
4: 1807
Right 1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116766229 Original CRISPR TTCTTTGTTGATTTTCTGTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr