ID: 1116766230

View in Genome Browser
Species Human (GRCh38)
Location 14:49073527-49073549
Sequence AATCTGCTCTATAGAACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116766229_1116766230 11 Left 1116766229 14:49073493-49073515 CCAGACAGAAAATCAACAAAGAA 0: 322
1: 596
2: 602
3: 679
4: 1807
Right 1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG No data
1116766228_1116766230 12 Left 1116766228 14:49073492-49073514 CCCAGACAGAAAATCAACAAAGA 0: 42
1: 143
2: 156
3: 203
4: 732
Right 1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116766230 Original CRISPR AATCTGCTCTATAGAACAAA TGG Intergenic
No off target data available for this crispr