ID: 1116767604

View in Genome Browser
Species Human (GRCh38)
Location 14:49091683-49091705
Sequence CTGAAGGAGTAGAGGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116767604_1116767606 -10 Left 1116767604 14:49091683-49091705 CCTTCTTGCCTCTACTCCTTCAG No data
Right 1116767606 14:49091696-49091718 ACTCCTTCAGAGACTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116767604 Original CRISPR CTGAAGGAGTAGAGGCAAGA AGG (reversed) Intergenic
No off target data available for this crispr