ID: 1116769172

View in Genome Browser
Species Human (GRCh38)
Location 14:49107271-49107293
Sequence ATAGATTAACTAGGATTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116769172_1116769175 -2 Left 1116769172 14:49107271-49107293 CCTGTGAATCCTAGTTAATCTAT No data
Right 1116769175 14:49107292-49107314 ATCAAACTTCAGAGTGGTCTTGG No data
1116769172_1116769174 -8 Left 1116769172 14:49107271-49107293 CCTGTGAATCCTAGTTAATCTAT No data
Right 1116769174 14:49107286-49107308 TAATCTATCAAACTTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116769172 Original CRISPR ATAGATTAACTAGGATTCAC AGG (reversed) Intergenic
No off target data available for this crispr