ID: 1116773256

View in Genome Browser
Species Human (GRCh38)
Location 14:49151367-49151389
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116773256_1116773265 30 Left 1116773256 14:49151367-49151389 CCTTTGGCCTGTGGATCACACTC No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data
1116773256_1116773264 29 Left 1116773256 14:49151367-49151389 CCTTTGGCCTGTGGATCACACTC No data
Right 1116773264 14:49151419-49151441 CTTCATCTTAAATTTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116773256 Original CRISPR GAGTGTGATCCACAGGCCAA AGG (reversed) Intergenic
No off target data available for this crispr