ID: 1116773262

View in Genome Browser
Species Human (GRCh38)
Location 14:49151406-49151428
Sequence TAAGATGAAGCAGCTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116773262_1116773264 -10 Left 1116773262 14:49151406-49151428 CCTTCTCCAGCTGCTTCATCTTA No data
Right 1116773264 14:49151419-49151441 CTTCATCTTAAATTTATTTGTGG No data
1116773262_1116773265 -9 Left 1116773262 14:49151406-49151428 CCTTCTCCAGCTGCTTCATCTTA No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116773262 Original CRISPR TAAGATGAAGCAGCTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr