ID: 1116773265

View in Genome Browser
Species Human (GRCh38)
Location 14:49151420-49151442
Sequence TTCATCTTAAATTTATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116773260_1116773265 -2 Left 1116773260 14:49151399-49151421 CCTTCCTCCTTCTCCAGCTGCTT No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data
1116773259_1116773265 6 Left 1116773259 14:49151391-49151413 CCTGGTTTCCTTCCTCCTTCTCC No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data
1116773262_1116773265 -9 Left 1116773262 14:49151406-49151428 CCTTCTCCAGCTGCTTCATCTTA No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data
1116773256_1116773265 30 Left 1116773256 14:49151367-49151389 CCTTTGGCCTGTGGATCACACTC No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data
1116773258_1116773265 23 Left 1116773258 14:49151374-49151396 CCTGTGGATCACACTCTCCTGGT No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data
1116773261_1116773265 -6 Left 1116773261 14:49151403-49151425 CCTCCTTCTCCAGCTGCTTCATC No data
Right 1116773265 14:49151420-49151442 TTCATCTTAAATTTATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116773265 Original CRISPR TTCATCTTAAATTTATTTGT GGG Intergenic
No off target data available for this crispr