ID: 1116774091 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:49159801-49159823 |
| Sequence | CCATCTTTGCTGATGGATCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1116774086_1116774091 | 12 | Left | 1116774086 | 14:49159766-49159788 | CCATTGAAGAGCCAAGAGTTTGA | No data | ||
| Right | 1116774091 | 14:49159801-49159823 | CCATCTTTGCTGATGGATCAGGG | No data | ||||
| 1116774087_1116774091 | 1 | Left | 1116774087 | 14:49159777-49159799 | CCAAGAGTTTGATTTCTACAGTC | No data | ||
| Right | 1116774091 | 14:49159801-49159823 | CCATCTTTGCTGATGGATCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1116774091 | Original CRISPR | CCATCTTTGCTGATGGATCA GGG | Intergenic | ||
| No off target data available for this crispr | |||||