ID: 1116774091

View in Genome Browser
Species Human (GRCh38)
Location 14:49159801-49159823
Sequence CCATCTTTGCTGATGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116774086_1116774091 12 Left 1116774086 14:49159766-49159788 CCATTGAAGAGCCAAGAGTTTGA No data
Right 1116774091 14:49159801-49159823 CCATCTTTGCTGATGGATCAGGG No data
1116774087_1116774091 1 Left 1116774087 14:49159777-49159799 CCAAGAGTTTGATTTCTACAGTC No data
Right 1116774091 14:49159801-49159823 CCATCTTTGCTGATGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116774091 Original CRISPR CCATCTTTGCTGATGGATCA GGG Intergenic
No off target data available for this crispr