ID: 1116774683

View in Genome Browser
Species Human (GRCh38)
Location 14:49166206-49166228
Sequence GCGTGCAACCCAAGATGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116774680_1116774683 4 Left 1116774680 14:49166179-49166201 CCTCTCTGACCAGGCCATGCTCT No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data
1116774682_1116774683 -10 Left 1116774682 14:49166193-49166215 CCATGCTCTCTCAGCGTGCAACC No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data
1116774675_1116774683 22 Left 1116774675 14:49166161-49166183 CCCCTTTTCCTGGGCTGTCCTCT No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data
1116774674_1116774683 23 Left 1116774674 14:49166160-49166182 CCCCCTTTTCCTGGGCTGTCCTC No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data
1116774676_1116774683 21 Left 1116774676 14:49166162-49166184 CCCTTTTCCTGGGCTGTCCTCTC No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data
1116774678_1116774683 14 Left 1116774678 14:49166169-49166191 CCTGGGCTGTCCTCTCTGACCAG No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data
1116774677_1116774683 20 Left 1116774677 14:49166163-49166185 CCTTTTCCTGGGCTGTCCTCTCT No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data
1116774681_1116774683 -5 Left 1116774681 14:49166188-49166210 CCAGGCCATGCTCTCTCAGCGTG No data
Right 1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116774683 Original CRISPR GCGTGCAACCCAAGATGACC AGG Intergenic
No off target data available for this crispr