ID: 1116774860

View in Genome Browser
Species Human (GRCh38)
Location 14:49167549-49167571
Sequence CAGGCCCGCCTCAAGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116774854_1116774860 -10 Left 1116774854 14:49167536-49167558 CCCCCACACAGGACAGGCCCGCC No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data
1116774844_1116774860 28 Left 1116774844 14:49167498-49167520 CCATGACTTTCCCCCAAGACTCT No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data
1116774849_1116774860 15 Left 1116774849 14:49167511-49167533 CCAAGACTCTCTCTGGTGAACCT No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data
1116774843_1116774860 29 Left 1116774843 14:49167497-49167519 CCCATGACTTTCCCCCAAGACTC No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data
1116774846_1116774860 18 Left 1116774846 14:49167508-49167530 CCCCCAAGACTCTCTCTGGTGAA No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data
1116774853_1116774860 -5 Left 1116774853 14:49167531-49167553 CCTGGCCCCCACACAGGACAGGC No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data
1116774848_1116774860 16 Left 1116774848 14:49167510-49167532 CCCAAGACTCTCTCTGGTGAACC No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data
1116774847_1116774860 17 Left 1116774847 14:49167509-49167531 CCCCAAGACTCTCTCTGGTGAAC No data
Right 1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116774860 Original CRISPR CAGGCCCGCCTCAAGTGCTG GGG Intergenic
No off target data available for this crispr