ID: 1116780147

View in Genome Browser
Species Human (GRCh38)
Location 14:49228048-49228070
Sequence GGTGCCCATCTGGTTTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116780147_1116780158 26 Left 1116780147 14:49228048-49228070 CCAGTACAAACCAGATGGGCACC No data
Right 1116780158 14:49228097-49228119 CCTCATCAAACTGCAGGAATGGG No data
1116780147_1116780152 20 Left 1116780147 14:49228048-49228070 CCAGTACAAACCAGATGGGCACC No data
Right 1116780152 14:49228091-49228113 TTACCCCCTCATCAAACTGCAGG No data
1116780147_1116780156 25 Left 1116780147 14:49228048-49228070 CCAGTACAAACCAGATGGGCACC No data
Right 1116780156 14:49228096-49228118 CCCTCATCAAACTGCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116780147 Original CRISPR GGTGCCCATCTGGTTTGTAC TGG (reversed) Intergenic