ID: 1116780152

View in Genome Browser
Species Human (GRCh38)
Location 14:49228091-49228113
Sequence TTACCCCCTCATCAAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116780148_1116780152 10 Left 1116780148 14:49228058-49228080 CCAGATGGGCACCAACAAGTCTA No data
Right 1116780152 14:49228091-49228113 TTACCCCCTCATCAAACTGCAGG No data
1116780149_1116780152 -1 Left 1116780149 14:49228069-49228091 CCAACAAGTCTAGAACTGCCCAT No data
Right 1116780152 14:49228091-49228113 TTACCCCCTCATCAAACTGCAGG No data
1116780147_1116780152 20 Left 1116780147 14:49228048-49228070 CCAGTACAAACCAGATGGGCACC No data
Right 1116780152 14:49228091-49228113 TTACCCCCTCATCAAACTGCAGG No data
1116780144_1116780152 29 Left 1116780144 14:49228039-49228061 CCATCTGCTCCAGTACAAACCAG No data
Right 1116780152 14:49228091-49228113 TTACCCCCTCATCAAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116780152 Original CRISPR TTACCCCCTCATCAAACTGC AGG Intergenic