ID: 1116780156

View in Genome Browser
Species Human (GRCh38)
Location 14:49228096-49228118
Sequence CCCTCATCAAACTGCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116780148_1116780156 15 Left 1116780148 14:49228058-49228080 CCAGATGGGCACCAACAAGTCTA No data
Right 1116780156 14:49228096-49228118 CCCTCATCAAACTGCAGGAATGG No data
1116780147_1116780156 25 Left 1116780147 14:49228048-49228070 CCAGTACAAACCAGATGGGCACC No data
Right 1116780156 14:49228096-49228118 CCCTCATCAAACTGCAGGAATGG No data
1116780149_1116780156 4 Left 1116780149 14:49228069-49228091 CCAACAAGTCTAGAACTGCCCAT No data
Right 1116780156 14:49228096-49228118 CCCTCATCAAACTGCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116780156 Original CRISPR CCCTCATCAAACTGCAGGAA TGG Intergenic