ID: 1116780157

View in Genome Browser
Species Human (GRCh38)
Location 14:49228097-49228119
Sequence CCCATTCCTGCAGTTTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116780157_1116780161 4 Left 1116780157 14:49228097-49228119 CCTCATCAAACTGCAGGAATGGG No data
Right 1116780161 14:49228124-49228146 CAAAAGCTCTCCCTGATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116780157 Original CRISPR CCCATTCCTGCAGTTTGATG AGG (reversed) Intergenic
No off target data available for this crispr