ID: 1116787277

View in Genome Browser
Species Human (GRCh38)
Location 14:49301449-49301471
Sequence GAGTTGTTTACATGGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116787277_1116787280 11 Left 1116787277 14:49301449-49301471 CCCAGGTGCCATGTAAACAACTC No data
Right 1116787280 14:49301483-49301505 TACCCAACATAATACAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116787277 Original CRISPR GAGTTGTTTACATGGCACCT GGG (reversed) Intergenic
No off target data available for this crispr