ID: 1116787280

View in Genome Browser
Species Human (GRCh38)
Location 14:49301483-49301505
Sequence TACCCAACATAATACAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116787279_1116787280 3 Left 1116787279 14:49301457-49301479 CCATGTAAACAACTCTGTACTGC No data
Right 1116787280 14:49301483-49301505 TACCCAACATAATACAAGAAAGG No data
1116787276_1116787280 24 Left 1116787276 14:49301436-49301458 CCACACTTAGATTCCCAGGTGCC No data
Right 1116787280 14:49301483-49301505 TACCCAACATAATACAAGAAAGG No data
1116787278_1116787280 10 Left 1116787278 14:49301450-49301472 CCAGGTGCCATGTAAACAACTCT No data
Right 1116787280 14:49301483-49301505 TACCCAACATAATACAAGAAAGG No data
1116787275_1116787280 25 Left 1116787275 14:49301435-49301457 CCCACACTTAGATTCCCAGGTGC No data
Right 1116787280 14:49301483-49301505 TACCCAACATAATACAAGAAAGG No data
1116787277_1116787280 11 Left 1116787277 14:49301449-49301471 CCCAGGTGCCATGTAAACAACTC No data
Right 1116787280 14:49301483-49301505 TACCCAACATAATACAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116787280 Original CRISPR TACCCAACATAATACAAGAA AGG Intergenic
No off target data available for this crispr