ID: 1116787490

View in Genome Browser
Species Human (GRCh38)
Location 14:49303621-49303643
Sequence ATCTCTAAGCTGATGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116787484_1116787490 -10 Left 1116787484 14:49303608-49303630 CCATCTCTTTCCAATCTCTAAGC No data
Right 1116787490 14:49303621-49303643 ATCTCTAAGCTGATGGGGGTTGG No data
1116787483_1116787490 3 Left 1116787483 14:49303595-49303617 CCTTAAGAAAATGCCATCTCTTT No data
Right 1116787490 14:49303621-49303643 ATCTCTAAGCTGATGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116787490 Original CRISPR ATCTCTAAGCTGATGGGGGT TGG Intergenic
No off target data available for this crispr