ID: 1116788439

View in Genome Browser
Species Human (GRCh38)
Location 14:49313367-49313389
Sequence GAATATGCACAGCTCCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116788439_1116788440 -3 Left 1116788439 14:49313367-49313389 CCAATCTGGAGCTGTGCATATTC No data
Right 1116788440 14:49313387-49313409 TTCTGACATAAGTTCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116788439 Original CRISPR GAATATGCACAGCTCCAGAT TGG (reversed) Intergenic
No off target data available for this crispr