ID: 1116788852

View in Genome Browser
Species Human (GRCh38)
Location 14:49318240-49318262
Sequence CAAGCTCATTGCCCAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116788848_1116788852 3 Left 1116788848 14:49318214-49318236 CCAAGGAAACATGGAAACCAGCA No data
Right 1116788852 14:49318240-49318262 CAAGCTCATTGCCCAGAGAGGGG No data
1116788845_1116788852 17 Left 1116788845 14:49318200-49318222 CCAGATCTGTATGCCCAAGGAAA No data
Right 1116788852 14:49318240-49318262 CAAGCTCATTGCCCAGAGAGGGG No data
1116788844_1116788852 18 Left 1116788844 14:49318199-49318221 CCCAGATCTGTATGCCCAAGGAA No data
Right 1116788852 14:49318240-49318262 CAAGCTCATTGCCCAGAGAGGGG No data
1116788847_1116788852 4 Left 1116788847 14:49318213-49318235 CCCAAGGAAACATGGAAACCAGC No data
Right 1116788852 14:49318240-49318262 CAAGCTCATTGCCCAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116788852 Original CRISPR CAAGCTCATTGCCCAGAGAG GGG Intergenic
No off target data available for this crispr