ID: 1116789014

View in Genome Browser
Species Human (GRCh38)
Location 14:49319580-49319602
Sequence CTAGAAAAGCAGATGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116789014_1116789017 -4 Left 1116789014 14:49319580-49319602 CCCAGGTCCATCTGCTTTTCTAG No data
Right 1116789017 14:49319599-49319621 CTAGTGTGATGACTTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116789014 Original CRISPR CTAGAAAAGCAGATGGACCT GGG (reversed) Intergenic
No off target data available for this crispr