ID: 1116791772

View in Genome Browser
Species Human (GRCh38)
Location 14:49346942-49346964
Sequence CCTGAGGGGCAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116791772_1116791779 -1 Left 1116791772 14:49346942-49346964 CCCTTCTCCTTCTGCCCCTCAGG No data
Right 1116791779 14:49346964-49346986 GAAACACTGATTCACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116791772 Original CRISPR CCTGAGGGGCAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr