ID: 1116793680

View in Genome Browser
Species Human (GRCh38)
Location 14:49366558-49366580
Sequence CTCAAGTCCTTGAGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116793680_1116793685 30 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793685 14:49366611-49366633 AAGATAGTCCCAGGCTCTGTGGG No data
1116793680_1116793682 7 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793682 14:49366588-49366610 TCTTTGAAATGTAAATGTCAAGG No data
1116793680_1116793683 21 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793683 14:49366602-49366624 ATGTCAAGGAAGATAGTCCCAGG No data
1116793680_1116793684 29 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793684 14:49366610-49366632 GAAGATAGTCCCAGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116793680 Original CRISPR CTCAAGTCCTTGAGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr