ID: 1116793682

View in Genome Browser
Species Human (GRCh38)
Location 14:49366588-49366610
Sequence TCTTTGAAATGTAAATGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116793678_1116793682 25 Left 1116793678 14:49366540-49366562 CCAGTTTTTCAACGTAGGCCTGT No data
Right 1116793682 14:49366588-49366610 TCTTTGAAATGTAAATGTCAAGG No data
1116793680_1116793682 7 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793682 14:49366588-49366610 TCTTTGAAATGTAAATGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116793682 Original CRISPR TCTTTGAAATGTAAATGTCA AGG Intergenic
No off target data available for this crispr