ID: 1116793683

View in Genome Browser
Species Human (GRCh38)
Location 14:49366602-49366624
Sequence ATGTCAAGGAAGATAGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116793681_1116793683 -4 Left 1116793681 14:49366583-49366605 CCATCTCTTTGAAATGTAAATGT No data
Right 1116793683 14:49366602-49366624 ATGTCAAGGAAGATAGTCCCAGG No data
1116793680_1116793683 21 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793683 14:49366602-49366624 ATGTCAAGGAAGATAGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116793683 Original CRISPR ATGTCAAGGAAGATAGTCCC AGG Intergenic
No off target data available for this crispr