ID: 1116793684

View in Genome Browser
Species Human (GRCh38)
Location 14:49366610-49366632
Sequence GAAGATAGTCCCAGGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116793681_1116793684 4 Left 1116793681 14:49366583-49366605 CCATCTCTTTGAAATGTAAATGT No data
Right 1116793684 14:49366610-49366632 GAAGATAGTCCCAGGCTCTGTGG No data
1116793680_1116793684 29 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793684 14:49366610-49366632 GAAGATAGTCCCAGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116793684 Original CRISPR GAAGATAGTCCCAGGCTCTG TGG Intergenic
No off target data available for this crispr