ID: 1116793685

View in Genome Browser
Species Human (GRCh38)
Location 14:49366611-49366633
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116793681_1116793685 5 Left 1116793681 14:49366583-49366605 CCATCTCTTTGAAATGTAAATGT No data
Right 1116793685 14:49366611-49366633 AAGATAGTCCCAGGCTCTGTGGG No data
1116793680_1116793685 30 Left 1116793680 14:49366558-49366580 CCTGTTTTTCTCAAGGACTTGAG No data
Right 1116793685 14:49366611-49366633 AAGATAGTCCCAGGCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116793685 Original CRISPR AAGATAGTCCCAGGCTCTGT GGG Intergenic