ID: 1116794631

View in Genome Browser
Species Human (GRCh38)
Location 14:49376509-49376531
Sequence CTTCTATTCCACTTGTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116794628_1116794631 20 Left 1116794628 14:49376466-49376488 CCTTCAGCATTACTAATATTGTT No data
Right 1116794631 14:49376509-49376531 CTTCTATTCCACTTGTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116794631 Original CRISPR CTTCTATTCCACTTGTATAT GGG Intergenic
No off target data available for this crispr