ID: 1116797467

View in Genome Browser
Species Human (GRCh38)
Location 14:49407333-49407355
Sequence GTGAACATCTTAAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116797464_1116797467 -10 Left 1116797464 14:49407320-49407342 CCATTCACTGCTAGTGAACATCT No data
Right 1116797467 14:49407333-49407355 GTGAACATCTTAAGGCAGGATGG No data
1116797463_1116797467 -9 Left 1116797463 14:49407319-49407341 CCCATTCACTGCTAGTGAACATC No data
Right 1116797467 14:49407333-49407355 GTGAACATCTTAAGGCAGGATGG No data
1116797461_1116797467 -3 Left 1116797461 14:49407313-49407335 CCTCTCCCCATTCACTGCTAGTG No data
Right 1116797467 14:49407333-49407355 GTGAACATCTTAAGGCAGGATGG No data
1116797462_1116797467 -8 Left 1116797462 14:49407318-49407340 CCCCATTCACTGCTAGTGAACAT No data
Right 1116797467 14:49407333-49407355 GTGAACATCTTAAGGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116797467 Original CRISPR GTGAACATCTTAAGGCAGGA TGG Intergenic
No off target data available for this crispr