ID: 1116797478

View in Genome Browser
Species Human (GRCh38)
Location 14:49407440-49407462
Sequence CTGTTTACAGAGATTTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116797478_1116797485 -5 Left 1116797478 14:49407440-49407462 CCCTGCTAAATCTCTGTAAACAG No data
Right 1116797485 14:49407458-49407480 AACAGGAATAAAAGGGAGAGGGG No data
1116797478_1116797484 -6 Left 1116797478 14:49407440-49407462 CCCTGCTAAATCTCTGTAAACAG No data
Right 1116797484 14:49407457-49407479 AAACAGGAATAAAAGGGAGAGGG No data
1116797478_1116797483 -7 Left 1116797478 14:49407440-49407462 CCCTGCTAAATCTCTGTAAACAG No data
Right 1116797483 14:49407456-49407478 TAAACAGGAATAAAAGGGAGAGG No data
1116797478_1116797486 -4 Left 1116797478 14:49407440-49407462 CCCTGCTAAATCTCTGTAAACAG No data
Right 1116797486 14:49407459-49407481 ACAGGAATAAAAGGGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116797478 Original CRISPR CTGTTTACAGAGATTTAGCA GGG (reversed) Intergenic
No off target data available for this crispr