ID: 1116797483

View in Genome Browser
Species Human (GRCh38)
Location 14:49407456-49407478
Sequence TAAACAGGAATAAAAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116797479_1116797483 -8 Left 1116797479 14:49407441-49407463 CCTGCTAAATCTCTGTAAACAGG No data
Right 1116797483 14:49407456-49407478 TAAACAGGAATAAAAGGGAGAGG No data
1116797477_1116797483 28 Left 1116797477 14:49407405-49407427 CCTTGGGTCAAACAAAGATGTCT No data
Right 1116797483 14:49407456-49407478 TAAACAGGAATAAAAGGGAGAGG No data
1116797478_1116797483 -7 Left 1116797478 14:49407440-49407462 CCCTGCTAAATCTCTGTAAACAG No data
Right 1116797483 14:49407456-49407478 TAAACAGGAATAAAAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116797483 Original CRISPR TAAACAGGAATAAAAGGGAG AGG Intergenic
No off target data available for this crispr