ID: 1116797486

View in Genome Browser
Species Human (GRCh38)
Location 14:49407459-49407481
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116797479_1116797486 -5 Left 1116797479 14:49407441-49407463 CCTGCTAAATCTCTGTAAACAGG No data
Right 1116797486 14:49407459-49407481 ACAGGAATAAAAGGGAGAGGGGG No data
1116797478_1116797486 -4 Left 1116797478 14:49407440-49407462 CCCTGCTAAATCTCTGTAAACAG No data
Right 1116797486 14:49407459-49407481 ACAGGAATAAAAGGGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116797486 Original CRISPR ACAGGAATAAAAGGGAGAGG GGG Intergenic
No off target data available for this crispr