ID: 1116798088

View in Genome Browser
Species Human (GRCh38)
Location 14:49413205-49413227
Sequence GCTGCTCCCCACCCTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116798088_1116798089 -4 Left 1116798088 14:49413205-49413227 CCTCACTCAGGGTGGGGAGCAGC No data
Right 1116798089 14:49413224-49413246 CAGCTGACCCTTCCCTTACCTGG No data
1116798088_1116798092 6 Left 1116798088 14:49413205-49413227 CCTCACTCAGGGTGGGGAGCAGC No data
Right 1116798092 14:49413234-49413256 TTCCCTTACCTGGTTCTAGCAGG No data
1116798088_1116798097 30 Left 1116798088 14:49413205-49413227 CCTCACTCAGGGTGGGGAGCAGC No data
Right 1116798097 14:49413258-49413280 CAAAAATTCTGACTTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116798088 Original CRISPR GCTGCTCCCCACCCTGAGTG AGG (reversed) Intergenic
No off target data available for this crispr