ID: 1116798089

View in Genome Browser
Species Human (GRCh38)
Location 14:49413224-49413246
Sequence CAGCTGACCCTTCCCTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116798082_1116798089 11 Left 1116798082 14:49413190-49413212 CCAAACTCACAAAGACCTCACTC No data
Right 1116798089 14:49413224-49413246 CAGCTGACCCTTCCCTTACCTGG No data
1116798081_1116798089 12 Left 1116798081 14:49413189-49413211 CCCAAACTCACAAAGACCTCACT No data
Right 1116798089 14:49413224-49413246 CAGCTGACCCTTCCCTTACCTGG No data
1116798088_1116798089 -4 Left 1116798088 14:49413205-49413227 CCTCACTCAGGGTGGGGAGCAGC No data
Right 1116798089 14:49413224-49413246 CAGCTGACCCTTCCCTTACCTGG No data
1116798079_1116798089 14 Left 1116798079 14:49413187-49413209 CCCCCAAACTCACAAAGACCTCA No data
Right 1116798089 14:49413224-49413246 CAGCTGACCCTTCCCTTACCTGG No data
1116798080_1116798089 13 Left 1116798080 14:49413188-49413210 CCCCAAACTCACAAAGACCTCAC No data
Right 1116798089 14:49413224-49413246 CAGCTGACCCTTCCCTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116798089 Original CRISPR CAGCTGACCCTTCCCTTACC TGG Intergenic
No off target data available for this crispr