ID: 1116798097

View in Genome Browser
Species Human (GRCh38)
Location 14:49413258-49413280
Sequence CAAAAATTCTGACTTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116798094_1116798097 -2 Left 1116798094 14:49413237-49413259 CCTTACCTGGTTCTAGCAGGCCA No data
Right 1116798097 14:49413258-49413280 CAAAAATTCTGACTTGCTGTAGG No data
1116798095_1116798097 -7 Left 1116798095 14:49413242-49413264 CCTGGTTCTAGCAGGCCAAAAAT No data
Right 1116798097 14:49413258-49413280 CAAAAATTCTGACTTGCTGTAGG No data
1116798088_1116798097 30 Left 1116798088 14:49413205-49413227 CCTCACTCAGGGTGGGGAGCAGC No data
Right 1116798097 14:49413258-49413280 CAAAAATTCTGACTTGCTGTAGG No data
1116798090_1116798097 4 Left 1116798090 14:49413231-49413253 CCCTTCCCTTACCTGGTTCTAGC No data
Right 1116798097 14:49413258-49413280 CAAAAATTCTGACTTGCTGTAGG No data
1116798093_1116798097 -1 Left 1116798093 14:49413236-49413258 CCCTTACCTGGTTCTAGCAGGCC No data
Right 1116798097 14:49413258-49413280 CAAAAATTCTGACTTGCTGTAGG No data
1116798091_1116798097 3 Left 1116798091 14:49413232-49413254 CCTTCCCTTACCTGGTTCTAGCA No data
Right 1116798097 14:49413258-49413280 CAAAAATTCTGACTTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116798097 Original CRISPR CAAAAATTCTGACTTGCTGT AGG Intergenic
No off target data available for this crispr