ID: 1116801568

View in Genome Browser
Species Human (GRCh38)
Location 14:49449674-49449696
Sequence GATTTCTACTGAAATGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116801565_1116801568 0 Left 1116801565 14:49449651-49449673 CCCAGGATCACTGATAGTCAACT No data
Right 1116801568 14:49449674-49449696 GATTTCTACTGAAATGGATCAGG No data
1116801563_1116801568 20 Left 1116801563 14:49449631-49449653 CCTAACAGCATGAATATTTACCC No data
Right 1116801568 14:49449674-49449696 GATTTCTACTGAAATGGATCAGG No data
1116801562_1116801568 21 Left 1116801562 14:49449630-49449652 CCCTAACAGCATGAATATTTACC No data
Right 1116801568 14:49449674-49449696 GATTTCTACTGAAATGGATCAGG No data
1116801566_1116801568 -1 Left 1116801566 14:49449652-49449674 CCAGGATCACTGATAGTCAACTG No data
Right 1116801568 14:49449674-49449696 GATTTCTACTGAAATGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116801568 Original CRISPR GATTTCTACTGAAATGGATC AGG Intergenic
No off target data available for this crispr