ID: 1116801706

View in Genome Browser
Species Human (GRCh38)
Location 14:49450748-49450770
Sequence TCCGTGGGTCCTCCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116801706_1116801713 9 Left 1116801706 14:49450748-49450770 CCACACCCGGGAGGACCCACGGA No data
Right 1116801713 14:49450780-49450802 TCATGCTGCCTGGACTTAGTAGG No data
1116801706_1116801715 28 Left 1116801706 14:49450748-49450770 CCACACCCGGGAGGACCCACGGA No data
Right 1116801715 14:49450799-49450821 TAGGTGCTAAATAAATGTGAAGG No data
1116801706_1116801716 29 Left 1116801706 14:49450748-49450770 CCACACCCGGGAGGACCCACGGA No data
Right 1116801716 14:49450800-49450822 AGGTGCTAAATAAATGTGAAGGG No data
1116801706_1116801711 -1 Left 1116801706 14:49450748-49450770 CCACACCCGGGAGGACCCACGGA No data
Right 1116801711 14:49450770-49450792 AAAGTGCCAGTCATGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116801706 Original CRISPR TCCGTGGGTCCTCCCGGGTG TGG (reversed) Intergenic
No off target data available for this crispr