ID: 1116805017

View in Genome Browser
Species Human (GRCh38)
Location 14:49485411-49485433
Sequence CGTCAAACAGCAGAAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116805012_1116805017 30 Left 1116805012 14:49485358-49485380 CCAGCCAGTAATGGAGTGCAAGA No data
Right 1116805017 14:49485411-49485433 CGTCAAACAGCAGAAATGGATGG No data
1116805015_1116805017 -3 Left 1116805015 14:49485391-49485413 CCAAAGATGAATGTAGTATTCGT No data
Right 1116805017 14:49485411-49485433 CGTCAAACAGCAGAAATGGATGG No data
1116805013_1116805017 26 Left 1116805013 14:49485362-49485384 CCAGTAATGGAGTGCAAGAGAGG No data
Right 1116805017 14:49485411-49485433 CGTCAAACAGCAGAAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116805017 Original CRISPR CGTCAAACAGCAGAAATGGA TGG Intergenic
No off target data available for this crispr