ID: 1116805182

View in Genome Browser
Species Human (GRCh38)
Location 14:49487520-49487542
Sequence CTCTAATTACAGAAGAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116805182_1116805184 1 Left 1116805182 14:49487520-49487542 CCTAGCCTCTTCTGTAATTAGAG No data
Right 1116805184 14:49487544-49487566 TAGCCATGTAACACAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116805182 Original CRISPR CTCTAATTACAGAAGAGGCT AGG (reversed) Intergenic
No off target data available for this crispr