ID: 1116805782

View in Genome Browser
Species Human (GRCh38)
Location 14:49492889-49492911
Sequence TTGGGATGGTACCTTAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116805782_1116805788 18 Left 1116805782 14:49492889-49492911 CCTGAATTAAGGTACCATCCCAA No data
Right 1116805788 14:49492930-49492952 AATTAAAGTCTTTCATAGATGGG No data
1116805782_1116805787 17 Left 1116805782 14:49492889-49492911 CCTGAATTAAGGTACCATCCCAA No data
Right 1116805787 14:49492929-49492951 AAATTAAAGTCTTTCATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116805782 Original CRISPR TTGGGATGGTACCTTAATTC AGG (reversed) Intergenic
No off target data available for this crispr