ID: 1116805876

View in Genome Browser
Species Human (GRCh38)
Location 14:49493750-49493772
Sequence TGAATGGGGAAGTGCATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116805876_1116805882 -3 Left 1116805876 14:49493750-49493772 CCCTGCATGCACTTCCCCATTCA No data
Right 1116805882 14:49493770-49493792 TCACTTCTCACTTTTTAAAAGGG No data
1116805876_1116805885 21 Left 1116805876 14:49493750-49493772 CCCTGCATGCACTTCCCCATTCA No data
Right 1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG No data
1116805876_1116805884 20 Left 1116805876 14:49493750-49493772 CCCTGCATGCACTTCCCCATTCA No data
Right 1116805884 14:49493793-49493815 ACTGTATGTTCAGGTAACACAGG No data
1116805876_1116805883 11 Left 1116805876 14:49493750-49493772 CCCTGCATGCACTTCCCCATTCA No data
Right 1116805883 14:49493784-49493806 TTAAAAGGGACTGTATGTTCAGG No data
1116805876_1116805881 -4 Left 1116805876 14:49493750-49493772 CCCTGCATGCACTTCCCCATTCA No data
Right 1116805881 14:49493769-49493791 TTCACTTCTCACTTTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116805876 Original CRISPR TGAATGGGGAAGTGCATGCA GGG (reversed) Intergenic
No off target data available for this crispr