ID: 1116805878

View in Genome Browser
Species Human (GRCh38)
Location 14:49493764-49493786
Sequence TAAAAAGTGAGAAGTGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116805878_1116805883 -3 Left 1116805878 14:49493764-49493786 CCCCATTCACTTCTCACTTTTTA No data
Right 1116805883 14:49493784-49493806 TTAAAAGGGACTGTATGTTCAGG No data
1116805878_1116805884 6 Left 1116805878 14:49493764-49493786 CCCCATTCACTTCTCACTTTTTA No data
Right 1116805884 14:49493793-49493815 ACTGTATGTTCAGGTAACACAGG No data
1116805878_1116805885 7 Left 1116805878 14:49493764-49493786 CCCCATTCACTTCTCACTTTTTA No data
Right 1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116805878 Original CRISPR TAAAAAGTGAGAAGTGAATG GGG (reversed) Intergenic
No off target data available for this crispr