ID: 1116805885

View in Genome Browser
Species Human (GRCh38)
Location 14:49493794-49493816
Sequence CTGTATGTTCAGGTAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116805878_1116805885 7 Left 1116805878 14:49493764-49493786 CCCCATTCACTTCTCACTTTTTA No data
Right 1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG No data
1116805877_1116805885 20 Left 1116805877 14:49493751-49493773 CCTGCATGCACTTCCCCATTCAC No data
Right 1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG No data
1116805879_1116805885 6 Left 1116805879 14:49493765-49493787 CCCATTCACTTCTCACTTTTTAA No data
Right 1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG No data
1116805880_1116805885 5 Left 1116805880 14:49493766-49493788 CCATTCACTTCTCACTTTTTAAA No data
Right 1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG No data
1116805876_1116805885 21 Left 1116805876 14:49493750-49493772 CCCTGCATGCACTTCCCCATTCA No data
Right 1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116805885 Original CRISPR CTGTATGTTCAGGTAACACA GGG Intergenic
No off target data available for this crispr