ID: 1116809105

View in Genome Browser
Species Human (GRCh38)
Location 14:49522313-49522335
Sequence CAGTGGAAATAGAGGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116809094_1116809105 8 Left 1116809094 14:49522282-49522304 CCATCCACAGGGTAGAAGGTAGG No data
Right 1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG No data
1116809099_1116809105 4 Left 1116809099 14:49522286-49522308 CCACAGGGTAGAAGGTAGGGGGG No data
Right 1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116809105 Original CRISPR CAGTGGAAATAGAGGGGTGA AGG Intergenic
No off target data available for this crispr