ID: 1116812640

View in Genome Browser
Species Human (GRCh38)
Location 14:49554349-49554371
Sequence GATGATGCTGCTTCACTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116812633_1116812640 22 Left 1116812633 14:49554304-49554326 CCTTGATTTCCTTGGCATGAGGT No data
Right 1116812640 14:49554349-49554371 GATGATGCTGCTTCACTATTAGG No data
1116812635_1116812640 13 Left 1116812635 14:49554313-49554335 CCTTGGCATGAGGTACTTCAGGT No data
Right 1116812640 14:49554349-49554371 GATGATGCTGCTTCACTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116812640 Original CRISPR GATGATGCTGCTTCACTATT AGG Intergenic
No off target data available for this crispr