ID: 1116817903

View in Genome Browser
Species Human (GRCh38)
Location 14:49599909-49599931
Sequence TCAGCCTCAGCCCGCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 182}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116817903_1116817920 5 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817920 14:49599937-49599959 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
1116817903_1116817915 -3 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817915 14:49599929-49599951 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
1116817903_1116817921 6 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817921 14:49599938-49599960 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
1116817903_1116817918 3 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
1116817903_1116817927 25 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817927 14:49599957-49599979 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
1116817903_1116817910 -10 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817910 14:49599922-49599944 CTGAGGCTGAGCCCGGGGCCGGG 0: 1
1: 1
2: 7
3: 98
4: 728
1116817903_1116817914 -4 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817914 14:49599928-49599950 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
1116817903_1116817919 4 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817919 14:49599936-49599958 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
1116817903_1116817928 29 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817928 14:49599961-49599983 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
1116817903_1116817925 21 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817925 14:49599953-49599975 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
1116817903_1116817922 7 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817922 14:49599939-49599961 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
1116817903_1116817924 18 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817924 14:49599950-49599972 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
1116817903_1116817912 -6 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817912 14:49599926-49599948 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
1116817903_1116817913 -5 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817913 14:49599927-49599949 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
1116817903_1116817911 -9 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817911 14:49599923-49599945 TGAGGCTGAGCCCGGGGCCGGGG 0: 1
1: 1
2: 8
3: 85
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116817903 Original CRISPR TCAGCCTCAGCCCGCCTGGA GGG (reversed) Intronic
901008028 1:6180922-6180944 TCAGCTGCACCCAGCCTGGAGGG - Intergenic
901068720 1:6506787-6506809 TCACCCTCAGCCTGCCTGTGAGG + Intronic
901779750 1:11586013-11586035 TCAGCCTCAGCCCTGGTTGAGGG - Intergenic
903602649 1:24553896-24553918 TCAACCCCAGCCCCACTGGAAGG + Intergenic
903640947 1:24860027-24860049 TGAGCCTCAGCCTCCCTAGATGG + Intergenic
904171424 1:28594146-28594168 CCAGCCTTAGCCCACCTGGTGGG + Exonic
904210181 1:28882158-28882180 TCAGCCTCTGGCAGCCTGGAAGG + Intergenic
904969263 1:34406260-34406282 TCAGACTCAGCCTCCCTGGGTGG - Intergenic
905452877 1:38068353-38068375 TCCGCCTCTGCCCGCCTGATCGG + Intergenic
906611755 1:47208705-47208727 TCAGCCAGAGCCCGGCTGGCTGG - Intergenic
911060688 1:93745275-93745297 TCAGCCTCTGCCCACCTCCAAGG + Intronic
911144576 1:94540707-94540729 TCAGGTTCAGCCCGCCAGGAAGG + Intronic
912503092 1:110135509-110135531 ACAGCCTCCTCCCACCTGGAAGG - Intergenic
917876882 1:179293984-179294006 CCGGCCTCAGCCCGCGGGGAAGG + Intronic
918382310 1:183968473-183968495 TCAGCCTCAGTCCCTGTGGAAGG - Intronic
920912838 1:210233634-210233656 GCAGCCTCAGCCCGCCGAGGAGG - Intronic
921099531 1:211916390-211916412 TCTGCCCCAGCCCATCTGGAAGG - Intergenic
922466252 1:225847034-225847056 CCAGCCTCAGGCCTCCTGGGGGG + Exonic
922573634 1:226647832-226647854 TAAGGCTCAGCCCACCTGGGTGG + Intronic
1062816404 10:504333-504355 CCAGCCTCGGCACGCCTGCATGG - Intronic
1062895171 10:1097666-1097688 TCTGCCCCAGCATGCCTGGAGGG + Intronic
1063123344 10:3120061-3120083 TCAGCCGGCGCCCGCCTGGCAGG - Intronic
1063254920 10:4316736-4316758 TCACCCTCAGCAGGCCTGAAGGG + Intergenic
1066354275 10:34666601-34666623 TCACCCTCAGCCCTCCAGGCAGG + Intronic
1067412779 10:46079399-46079421 ACAGCCTCAGTCTACCTGGAGGG + Intergenic
1067439701 10:46301742-46301764 TCACCCACAGCCCGCCTTGAAGG + Intronic
1067537478 10:47124342-47124364 TCTGCCCCAGCAGGCCTGGAGGG + Intergenic
1067581848 10:47451325-47451347 TCACCCACAGCCCGCCTTGAAGG + Intergenic
1073070210 10:100788485-100788507 TCAGCCTCAGCCAACATGGCAGG - Intronic
1076794454 10:132791856-132791878 TCAGCCTCAGCCCTGCTGCGGGG + Intergenic
1076839828 10:133040555-133040577 TCACCCTCAGCCCCCCTGCACGG - Intergenic
1077225559 11:1437742-1437764 CCAGGCACAGCCTGCCTGGAAGG + Intronic
1077423721 11:2464770-2464792 TCAGCCCCAGCCCACCTAGGAGG - Intronic
1077554092 11:3217749-3217771 TCATCCTCAGCAGGCCTGGCTGG + Intergenic
1079127806 11:17731221-17731243 AGAGCCTCAGCCCTCCTGGTGGG - Intergenic
1080754459 11:35182941-35182963 TCAGTCGCAGCCTGCCTAGATGG - Intronic
1083063652 11:59900187-59900209 TCCACCTCAGCCCACCTGCAAGG - Intergenic
1083968736 11:66059340-66059362 TCAGGCCCAGCCCTCCTGGTGGG + Intronic
1084039174 11:66531547-66531569 TGAGCCTCAGCACCCCTGCAGGG - Intronic
1084611967 11:70208983-70209005 TCAGCCTCACCCCTCCTCTAGGG + Intergenic
1084880976 11:72171681-72171703 CCATCCTCAGCCCACCTGGGAGG - Intergenic
1085768405 11:79304087-79304109 GAAGCCTCAGCCCTCCTGGTAGG - Intronic
1089119801 11:116125509-116125531 TCAGCAACAGCCTCCCTGGAAGG + Intergenic
1089660424 11:119981911-119981933 GCAGCCTCAGCCCTTCTTGAGGG + Intergenic
1091252376 11:134154539-134154561 GCAGCCTCACCCCTCCTGGGTGG + Intronic
1092148683 12:6232371-6232393 TTACCCTCAGCCCTTCTGGAAGG - Intronic
1092164761 12:6336117-6336139 TCTGCCTCAAGCCCCCTGGATGG - Intronic
1096184394 12:49568675-49568697 TCAGCCGGACCCCACCTGGACGG + Intronic
1096470930 12:51875226-51875248 TCAGCTTTAGCCAACCTGGATGG - Intergenic
1097494607 12:60315093-60315115 TCAGCCTCTGGCAGCCTGGATGG + Intergenic
1104379581 12:128295401-128295423 TCAGCCTCAGACCTACTTGAGGG + Intronic
1104750862 12:131237506-131237528 TCCACCTCAGCCTCCCTGGATGG + Intergenic
1104848735 12:131860856-131860878 CCGGCCTCAGCCTGCCTTGAGGG - Intergenic
1106193627 13:27475259-27475281 TCAGCCCCAGCCCACCTGGCAGG + Intergenic
1106423613 13:29604763-29604785 TCAGCCTCTGCCAGCCCTGAGGG + Intergenic
1106553782 13:30792911-30792933 ACAGCCTGAGCCTGCCTGGCTGG - Intergenic
1107299364 13:38948826-38948848 TCAGCCTGGGCCAGGCTGGAAGG - Intergenic
1108377147 13:49824206-49824228 ACAGACTCAGACTGCCTGGAAGG + Intergenic
1112659187 13:101487962-101487984 TCAGCCTCAACCTCCCTGCATGG - Intronic
1116817903 14:49599909-49599931 TCAGCCTCAGCCCGCCTGGAGGG - Intronic
1119363404 14:74070628-74070650 TCAGAGTCAGCCTTCCTGGATGG + Intronic
1119386160 14:74259131-74259153 TCACCTGCAGCCCTCCTGGATGG + Intronic
1120935600 14:89892473-89892495 CCAGCCTTAGCCCACCTGGTGGG + Intronic
1121118667 14:91361719-91361741 ACAGCCTCAGCCCTCCTTTAGGG + Intronic
1122509290 14:102253373-102253395 ACAGCCTCAGCCGGCCTCGGAGG + Intronic
1122619933 14:103050309-103050331 TCAGCCTCAGGCCTCCTTGCAGG - Intronic
1122876138 14:104666245-104666267 ACAGCCTCAGCCCTACTGTAGGG - Intergenic
1123759289 15:23420434-23420456 ACAGCCTCAGCCTGGCTGGCAGG + Intergenic
1124342211 15:28896943-28896965 TAAGCCTATGCCAGCCTGGAAGG - Intronic
1124844706 15:33279158-33279180 AAAGCCTCAGCCTGCCTGCAAGG + Intergenic
1125539943 15:40464463-40464485 TCATCATCAGCTCTCCTGGAAGG - Exonic
1127053652 15:55110666-55110688 TCAGCCTCTGCCCCACAGGAAGG - Intergenic
1127464089 15:59227013-59227035 CCGGCCTCAGCCTGCCTGCAGGG - Intronic
1128726460 15:69991726-69991748 TGAGCCTCAGCCTGCCTGAAAGG - Intergenic
1131461097 15:92617967-92617989 GCAGCCTCCGCCTGCCAGGAAGG - Exonic
1132344328 15:101099298-101099320 TCAATCTCAGCCGGCCTGGGTGG - Intergenic
1132592315 16:731392-731414 ACACCCTGAGCCCGCCAGGAGGG + Intronic
1132923126 16:2410405-2410427 TCAACCTCAGCCAGCCAGGGAGG + Intergenic
1133976313 16:10601930-10601952 TCCTCCTCAGCTGGCCTGGAGGG + Intergenic
1134457061 16:14402424-14402446 ACAGCCTCAGCCTGGCTGGCAGG - Intergenic
1135844768 16:25909010-25909032 TCAGCCTCAGCCAGCAATGATGG - Intronic
1136303726 16:29355031-29355053 CCTGCCTCAGCCCGCCCGGTAGG + Intergenic
1136932510 16:34432074-34432096 CCAGCCTCAGCCTGCCCAGACGG + Intergenic
1136972062 16:34979740-34979762 CCAGCCTCAGCCTGCCCAGACGG - Intergenic
1137599094 16:49744027-49744049 GCAGCCTCAGCCCACCTCCAAGG + Intronic
1139529750 16:67537401-67537423 CCTGACTCAGCCCGCCTGGATGG - Intronic
1141093702 16:81148109-81148131 TCAACCTCAGCTAGCCTGGGGGG - Intergenic
1141308538 16:82890372-82890394 CCAGCCTCAGCCTTCTTGGAAGG + Intronic
1141435139 16:83995798-83995820 TCAGCCTCATCCCTGCAGGAGGG - Intronic
1141741840 16:85898840-85898862 TCCGCCCGAGCCGGCCTGGAAGG + Exonic
1141796930 16:86281312-86281334 TCAGACCCAGCCAGCCTGCATGG + Intergenic
1142599012 17:1044028-1044050 TCAGGCCCAGCCCGCCAAGAAGG + Intronic
1142972785 17:3623958-3623980 TCAGCATCACCCCGCCTGCTGGG - Intronic
1144665795 17:17101450-17101472 TCAGCCTCAGCCTGAGTGGCTGG - Intronic
1144831387 17:18133204-18133226 TCAGCCTCTGCCCTCATGCAGGG + Exonic
1146645414 17:34573892-34573914 TCAGCCTCATCCTGACTGGTAGG - Intergenic
1147343119 17:39767079-39767101 TCAGTCTCAGTCAGCCAGGACGG - Intronic
1150294339 17:63999633-63999655 TCTGCCCCTGCCAGCCTGGATGG - Intronic
1152121600 17:78422234-78422256 TCAGCCTCCCCCAGCCTGGCTGG - Intronic
1154004244 18:10513153-10513175 TCAGCCTCAGCCAGGCTGGCAGG - Intergenic
1154510575 18:15096774-15096796 CCAGCCTCAGTCTGACTGGATGG - Intergenic
1155054029 18:22169813-22169835 GCCGCCTCAGCCCGCCCGGAGGG - Intronic
1155542803 18:26885315-26885337 TCATCCACAACCCCCCTGGATGG + Intergenic
1156452712 18:37275518-37275540 TCGGCCTCCTCCCGCCTGCAGGG + Intronic
1158938261 18:62384590-62384612 TCCGCCTCAGTGGGCCTGGAGGG + Intronic
1160957555 19:1700432-1700454 TCAGCCTCTGACCCCCTGAAAGG - Intergenic
1162094636 19:8303075-8303097 TCAGCTTCACCCAGCCTGGTTGG - Intronic
1162936386 19:13983648-13983670 TAAGCCTGAGCCCCCCTGGAGGG + Intronic
1164400797 19:27900819-27900841 TGAGCCTCTTCCCTCCTGGATGG + Intergenic
1164435200 19:28222729-28222751 TCAGCCTCAGCCCTCCAGCTTGG - Intergenic
1165364759 19:35358742-35358764 GCAGGCTGACCCCGCCTGGAAGG + Intronic
1165366577 19:35371211-35371233 GCAGGCTGACCCCGCCTGGAAGG + Intronic
1167424402 19:49422624-49422646 ACAGCCTCCGCCCCCCAGGACGG - Exonic
925108643 2:1314542-1314564 GCAGCCACAGCTGGCCTGGAGGG - Intronic
926149159 2:10415190-10415212 TCTGCCCCAGGCCGCATGGAGGG + Intronic
929556130 2:42926752-42926774 CCAGGCCCAGCCAGCCTGGAGGG - Intergenic
929966894 2:46542965-46542987 TCAGCCCCAGCCCGCCTGGGGGG - Exonic
932043095 2:68319969-68319991 TCAGCCTCCTCCCGCCTGGCTGG - Exonic
933222956 2:79712361-79712383 TAAGCCTCAGCCCAACTGCATGG - Intronic
936249217 2:110854497-110854519 TCAGCCCCAGCCCCCAAGGAGGG + Intronic
938455650 2:131460917-131460939 TCAGCCCCGGCCCGCCTGGGGGG - Intergenic
938505791 2:131881221-131881243 CCAGCCTCAGTCTGACTGGATGG - Intergenic
938528895 2:132163047-132163069 TCATCTGCAGCCCTCCTGGATGG + Intronic
939008692 2:136819689-136819711 TCAGCCTCAGCTGGACTGGGGGG - Intronic
942271787 2:174282686-174282708 TGAGCCACAGCCTGCTTGGAGGG - Intergenic
947722804 2:232379868-232379890 CCTGCCTCCGCCCGCCAGGAGGG + Exonic
947727148 2:232407949-232407971 CCTGCCTCGGCCCGCCAGGAGGG + Exonic
947736306 2:232457254-232457276 CCTGCCTCAGCCCGCCAGGAGGG + Exonic
947983208 2:234427247-234427269 TCAGGCTCTGCCTGCCTGGAGGG - Intergenic
948913599 2:241018867-241018889 GCTGCCCCAGCCCGCCTGGTTGG - Intronic
1172282811 20:33720062-33720084 TCAGCCCCAGCCCGGCCCGACGG + Intronic
1173662280 20:44742935-44742957 TCAGCCACAGCCTGGCTGGGAGG + Intergenic
1175416727 20:58806082-58806104 TCACCCTCAGCCCGCACGGCTGG + Intergenic
1175764283 20:61582055-61582077 TCACCCGCAGCCAGGCTGGAGGG - Intronic
1175887683 20:62302124-62302146 TCACCCTCTGGACGCCTGGATGG - Exonic
1176078170 20:63258595-63258617 GCAGCCCCAGCCCGCCCGCAGGG + Intronic
1176701201 21:10052660-10052682 TCAGCCTCCGCCCGACTAGCTGG - Intergenic
1176787293 21:13272636-13272658 CCAGCCTCAGTCTGACTGGATGG + Intergenic
1177986453 21:27981130-27981152 CCAGCCTCAGTCTGACTGGATGG + Intergenic
1178580080 21:33831165-33831187 TCAGCCTCAGACTGCCAGGCGGG + Intronic
1179359233 21:40689961-40689983 TCAGCCCCAGCCAGTGTGGAGGG + Intronic
1179410152 21:41156315-41156337 TCAGCCTCCACCCACCTGAAAGG + Intergenic
1180957124 22:19746111-19746133 TCGGCCTCAACCAGCCTGGGAGG + Intergenic
1181590987 22:23884506-23884528 TCAGTCTCAGTCTCCCTGGATGG - Intronic
1182423574 22:30260272-30260294 CCAACCTCTGCCCTCCTGGAGGG + Intergenic
1182726068 22:32446771-32446793 TAAGCCTGAGCCCAACTGGAAGG - Intronic
1183414908 22:37676436-37676458 CCAGCCACAGCCCGACTGCAGGG + Intronic
1184715820 22:46281215-46281237 TCAGCTGCCGCCTGCCTGGAAGG - Intronic
1185241238 22:49748817-49748839 TCAGCCTCAGCCCCAGAGGAAGG + Intergenic
950883959 3:16346831-16346853 TCATCCTCAGCCTGTCTGCAGGG - Intronic
954443316 3:50533551-50533573 TCAGCCTCCCCCTGCCAGGAGGG - Intergenic
959977673 3:112480319-112480341 TTGGACTCAGCCCGCCTGCAAGG + Intronic
963043267 3:141084351-141084373 TCACCCTCATGCCGCCTGGGTGG + Intronic
968582721 4:1402485-1402507 TGAGCCTCAGCCAGCTTGGCGGG + Intergenic
968964437 4:3762884-3762906 GCAGCCTCAGCTCGGGTGGAGGG - Intergenic
974318217 4:60309581-60309603 TGAGGCTGAGCCAGCCTGGATGG - Intergenic
975110978 4:70626280-70626302 TCTGCCTCACCCAGGCTGGAGGG + Intergenic
978251135 4:106632599-106632621 AAAGCCTCAGCCAACCTGGAGGG - Intergenic
985561020 5:585812-585834 GCAGCCTCAGCACCTCTGGATGG - Intergenic
985689691 5:1300243-1300265 TCAGCCTCAGCCTCCCAGGCCGG + Intergenic
986337770 5:6767866-6767888 TAGGCCTCAGCCCGCATGGGGGG + Intergenic
986707290 5:10462459-10462481 TGAGCCTCAGCCCACATGGGTGG - Intronic
995479856 5:112583025-112583047 TGAGCCACAAACCGCCTGGATGG + Intergenic
999135152 5:149313788-149313810 TCTGCCTCAGCACCCCAGGAAGG + Intronic
1001382063 5:171311659-171311681 TCCCCCGCAGCCCGCCTGGGGGG - Exonic
1006608137 6:35274296-35274318 TCTGCCTCAGCCAGCCCAGAGGG - Intronic
1007219213 6:40265216-40265238 ACAGTCTCAGCCAGCCTGGTGGG - Intergenic
1009307119 6:62103749-62103771 GCAGCAGCAGCCTGCCTGGAGGG - Intronic
1015155883 6:130095865-130095887 TCAGGCTCTGCCCTCCTGGATGG - Intronic
1017892431 6:158649964-158649986 TCAGCCTGTGCCCGACAGGAAGG + Intergenic
1018345973 6:162899622-162899644 TCAGCCTCACCCTGGCTGGGAGG - Intronic
1018951739 6:168382803-168382825 TAAGCCTCAGTACCCCTGGAAGG + Intergenic
1019349949 7:549966-549988 TCAGCCTCATCTCCCCTGGGGGG + Exonic
1020120446 7:5500377-5500399 CCAGCCTCTGCACTCCTGGAGGG + Intronic
1021101220 7:16587154-16587176 TCAGCCTCCTCCCACCTGTAAGG + Intergenic
1022097534 7:27150390-27150412 TCCACCTCTGCCAGCCTGGAGGG + Intronic
1022527769 7:31049560-31049582 TCAGCTGCTGCCCGCCTGGCTGG + Intergenic
1022923137 7:35036718-35036740 TCGGCCTCTGACCGCCAGGATGG - Intronic
1027600284 7:80231880-80231902 TCAGCCCCAGCCAGTCTGTATGG + Intergenic
1035790013 8:2296029-2296051 ACAGCCACAGCCAGCCTGGATGG + Intergenic
1035802792 8:2425676-2425698 ACAGCCACAGCCAGCCTGGATGG - Intergenic
1035856125 8:2978298-2978320 TCAGCCTCAGCCTACCAGGTAGG - Intronic
1036721451 8:11179438-11179460 ATAGCCTCAGCCAACCTGGAGGG - Intronic
1037074040 8:14690369-14690391 TCAGCCTGAGACCTCCTGGCTGG - Intronic
1039845672 8:41323884-41323906 GCAGCCTCAGCTCACCAGGAGGG + Intergenic
1039990469 8:42483257-42483279 TCCGCCTCAGCCTCCCTGGTAGG - Intronic
1043611755 8:82072753-82072775 TCAACCTCAGCCAGCCTGAAGGG - Intergenic
1046450659 8:114386100-114386122 CCAGCCTTGGCCAGCCTGGAAGG - Intergenic
1047435779 8:124834608-124834630 TCCGCTTCTGCACGCCTGGAAGG + Intergenic
1047754735 8:127909774-127909796 TCAGCCCCAGAGCGCCTGCATGG - Intergenic
1049298385 8:141855873-141855895 GCAGCCTCAGCCCGGGTGGAAGG - Intergenic
1052883821 9:33624087-33624109 TCTGCCTCGGCCTGCCTGGGTGG - Intergenic
1057334354 9:94144117-94144139 TCAGCCTCCGCCAGGCTGTATGG - Intergenic
1059269390 9:113062431-113062453 CCATCCGCAGCCCGCCGGGATGG - Intergenic
1059270523 9:113067878-113067900 CCATCCGCAGCCCGCCGGGATGG - Intergenic
1059272791 9:113078772-113078794 CCATCCACAGCCCGCCGGGATGG - Intergenic
1059273925 9:113084214-113084236 CCATCCGCAGCCCGCCGGGATGG - Intergenic
1059275060 9:113089658-113089680 CCATCCGCAGCCCGCCGGGATGG - Intergenic
1059329111 9:113524044-113524066 TCAGGCTGAGCCCGCCTGGAGGG - Intronic
1060883152 9:127132872-127132894 TCATCCTCACCCTGCCAGGAAGG + Intronic
1061758637 9:132834071-132834093 TCAGCCTCAGCTTGCCTCGTTGG - Intronic
1061968608 9:134030998-134031020 TCACCCTCAGCCCGCCAGCAAGG + Exonic
1062309926 9:135930113-135930135 TCAGCCTCAGCCCAGCTGTGGGG - Intergenic
1062504872 9:136868100-136868122 ACAGCCTCAGCCGGCCAGCAAGG + Intronic
1062606813 9:137352187-137352209 TCAGCCTCAGTCGCCCTGGGAGG + Exonic
1202786218 9_KI270719v1_random:22739-22761 TCAGCCTCCGCCCGACTAGCTGG - Intergenic
1186760627 X:12718355-12718377 TCAGCCTCAGGAAGCTTGGAAGG - Exonic
1194376335 X:93137793-93137815 TCAGCCTAAGCCTGTCTGGAAGG + Intergenic