ID: 1116817904

View in Genome Browser
Species Human (GRCh38)
Location 14:49599910-49599932
Sequence CTCAGCCTCAGCCCGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 272}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116817904_1116817922 6 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817922 14:49599939-49599961 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
1116817904_1116817918 2 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
1116817904_1116817924 17 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817924 14:49599950-49599972 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
1116817904_1116817914 -5 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817914 14:49599928-49599950 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
1116817904_1116817921 5 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817921 14:49599938-49599960 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
1116817904_1116817911 -10 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817911 14:49599923-49599945 TGAGGCTGAGCCCGGGGCCGGGG 0: 1
1: 1
2: 8
3: 85
4: 618
1116817904_1116817927 24 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817927 14:49599957-49599979 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
1116817904_1116817920 4 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817920 14:49599937-49599959 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
1116817904_1116817912 -7 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817912 14:49599926-49599948 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
1116817904_1116817913 -6 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817913 14:49599927-49599949 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
1116817904_1116817928 28 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817928 14:49599961-49599983 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
1116817904_1116817919 3 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817919 14:49599936-49599958 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
1116817904_1116817915 -4 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817915 14:49599929-49599951 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
1116817904_1116817925 20 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817925 14:49599953-49599975 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116817904 Original CRISPR CTCAGCCTCAGCCCGCCTGG AGG (reversed) Intronic
900132380 1:1092565-1092587 CTGGGCCTCAGCCCCCCTCGGGG - Intronic
900242796 1:1624954-1624976 CTCAGCCTTAGCCTGCTGGGGGG + Intronic
900300491 1:1974449-1974471 CACAGCCTCAGGCCGGCAGGTGG - Intronic
900673340 1:3869372-3869394 CTAAGTCTCACCCAGCCTGGGGG + Intronic
901006085 1:6172118-6172140 CTCAGCCTAGGCCAGCCTGGGGG - Intronic
901146908 1:7071022-7071044 CTCATGCTCAGCCAGCCTGTGGG - Intronic
901228948 1:7631286-7631308 CTCAGCCTCAGTGCCCCGGGTGG - Intronic
901521234 1:9786752-9786774 CCCAGCCATAGACCGCCTGGTGG - Intronic
901779751 1:11586014-11586036 CTCAGCCTCAGCCCTGGTTGAGG - Intergenic
901800722 1:11706518-11706540 CTCAGCCTCTGGCAGCCTGGAGG - Exonic
903534850 1:24060181-24060203 CTCAGCCTCAGGCCACGAGGAGG - Intronic
904171422 1:28594145-28594167 CCCAGCCTTAGCCCACCTGGTGG + Exonic
905626155 1:39491689-39491711 CGCAGCCACAGCCGGACTGGTGG + Exonic
909795409 1:79729244-79729266 CTCTGCCTCAGAACTCCTGGAGG + Intergenic
910427463 1:87131535-87131557 CTGAGCCTCAGACCCGCTGGAGG - Intronic
910759223 1:90718588-90718610 CTCGGGCTCAGCCCGGCGGGAGG + Intergenic
912698154 1:111856591-111856613 CTGAGCCTCTGCCCGACTTGGGG + Intronic
914884887 1:151576729-151576751 TTCAGCCTCAGCCTCCCAGGAGG + Intronic
915236357 1:154486026-154486048 CTCAGCCTCAGCACGGCTGATGG + Exonic
915748013 1:158180156-158180178 CTAAGCCTTAGCTCACCTGGAGG - Exonic
915749772 1:158195703-158195725 CTCAGCCTCAGCCTTCCTGTCGG + Intergenic
915911365 1:159917688-159917710 CTCACCCCAAGCCCGCCTGAGGG + Intergenic
920668180 1:207981993-207982015 CTCAGCCTCATGACCCCTGGAGG + Intergenic
921634688 1:217477876-217477898 CTGACCCTCAGCCCTTCTGGTGG + Intronic
922466250 1:225847033-225847055 CCCAGCCTCAGGCCTCCTGGGGG + Exonic
922785473 1:228280417-228280439 GTCGACCTCTGCCCGCCTGGAGG + Exonic
1062895170 10:1097665-1097687 CTCTGCCCCAGCATGCCTGGAGG + Intronic
1063714429 10:8513564-8513586 CTGAGGCTCAGCCCACCTGCGGG - Intergenic
1067412778 10:46079398-46079420 CACAGCCTCAGTCTACCTGGAGG + Intergenic
1067429404 10:46233243-46233265 CTCAGCCACAGCCCCCCAGGTGG + Intergenic
1067527363 10:47046716-47046738 CTCAGCCGCTGCCCTCCCGGAGG + Intergenic
1067537477 10:47124341-47124363 CTCTGCCCCAGCAGGCCTGGAGG + Intergenic
1068059123 10:52044994-52045016 CTGAGTCTCAGCCAGCCTGTTGG + Intronic
1069604809 10:69732423-69732445 CTCACTCTCAGTCCTCCTGGGGG - Intergenic
1069744333 10:70705414-70705436 CTGAGCCCCAGCCCGGCTGGCGG - Intronic
1069993905 10:72331259-72331281 TCCAGCCTCAGCCCCCGTGGGGG + Intergenic
1074188153 10:111114576-111114598 CTGAGTCACAGCCTGCCTGGCGG + Intergenic
1075456949 10:122591035-122591057 CACAGCCTCTGCCTGTCTGGAGG - Intronic
1076781589 10:132727687-132727709 CTCACCCTCAGCCTCCCTGGTGG + Intronic
1076794453 10:132791855-132791877 CTCAGCCTCAGCCCTGCTGCGGG + Intergenic
1077341575 11:2028595-2028617 CTCATCCTGTGCCAGCCTGGCGG - Intergenic
1079127807 11:17731222-17731244 CAGAGCCTCAGCCCTCCTGGTGG - Intergenic
1083361401 11:62111285-62111307 CTCAGCCTCAGCCTCCCAGCTGG - Intergenic
1083713197 11:64561127-64561149 TTCAGACTCAGCCGGCCTGGAGG + Intronic
1083763771 11:64832631-64832653 CTGAGGCTCAGCCCGCCCAGTGG - Exonic
1083968735 11:66059339-66059361 GTCAGGCCCAGCCCTCCTGGTGG + Intronic
1084039175 11:66531548-66531570 CTGAGCCTCAGCACCCCTGCAGG - Intronic
1084328570 11:68416214-68416236 CTCAGCATCTGCCCCGCTGGAGG - Intronic
1084336980 11:68464240-68464262 CTCTGCCTCAGCCTCCCTAGTGG + Intronic
1084611966 11:70208982-70209004 CTCAGCCTCACCCCTCCTCTAGG + Intergenic
1084661784 11:70550394-70550416 CCCTGCCCCAGCCCACCTGGGGG - Intronic
1087144419 11:94798122-94798144 TTCTGCCTCTTCCCGCCTGGGGG + Intronic
1088843923 11:113649408-113649430 CACAGCCTGAGCCCCCCTGACGG - Intergenic
1091347485 11:134864866-134864888 CTCCCGCTCAGCCAGCCTGGGGG - Intergenic
1202824561 11_KI270721v1_random:83784-83806 CTCATCCTGTGCCAGCCTGGCGG - Intergenic
1092117480 12:6019542-6019564 CTCAGCCTCGGACAGCCTGGAGG + Exonic
1096532998 12:52253619-52253641 CTCGGCCTCGGCCCGGCTGCGGG + Intronic
1096538076 12:52288002-52288024 CTCGGCCTCGGCCCGGCTGCGGG + Exonic
1096540703 12:52305364-52305386 CTCGGCCTCAGCCCGGCTACGGG - Exonic
1096542659 12:52316877-52316899 CTCGGCCTCAGCCCGGCTACGGG + Exonic
1096720249 12:53516028-53516050 TTCAGACTCAGCCCTCCTGGAGG - Exonic
1096782055 12:53997237-53997259 CCCAGCCTCAGCTTTCCTGGAGG - Intronic
1097067048 12:56328343-56328365 CTCATTCTCATCCAGCCTGGTGG + Exonic
1102099916 12:110270333-110270355 CTCAGCCTTAGCCAGACTGCTGG + Intergenic
1102689864 12:114751861-114751883 CTCAGCAGCAGCCTGGCTGGTGG + Intergenic
1103949205 12:124542108-124542130 CTCAGCCTCTTCCTGCATGGAGG + Intronic
1104379580 12:128295400-128295422 CTCAGCCTCAGACCTACTTGAGG + Intronic
1104721143 12:131045806-131045828 CTCAGCCTGTGCCCGCCCTGAGG - Intronic
1104748957 12:131226557-131226579 CCCAGCCTCAGCCACCCTGTTGG + Intergenic
1104750069 12:131232750-131232772 CTCAGCCTCATCCTGGCTGGAGG - Intergenic
1104782645 12:131431710-131431732 CTCAGCCTCATCCTGGCTGGAGG + Intergenic
1104784168 12:131439007-131439029 CCCAGCCTCAGCCGCCCTGTTGG - Intergenic
1104931939 12:132344401-132344423 CTCAGCATCTGCCCGCGCGGTGG - Intergenic
1108254049 13:48593801-48593823 CTCTGCCTCAACCCACCTGAGGG + Intergenic
1113577949 13:111407564-111407586 CCCAGCCTGAGCCCATCTGGGGG - Intergenic
1113992396 14:16037969-16037991 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1114683951 14:24510132-24510154 CTCACCCTCAGCCAGGCAGGTGG - Intergenic
1116817904 14:49599910-49599932 CTCAGCCTCAGCCCGCCTGGAGG - Intronic
1119533646 14:75381847-75381869 CAGAGCCTTAGCCCCCCTGGGGG + Intergenic
1120392333 14:83924530-83924552 CCCAGCCTCAGGCCCCCAGGAGG - Intergenic
1120935598 14:89892472-89892494 CCCAGCCTTAGCCCACCTGGTGG + Intronic
1121618932 14:95332700-95332722 ATCAGCCCCTGCCCGCATGGTGG + Intergenic
1121816431 14:96932539-96932561 CTCTATCTCAGCCCTCCTGGAGG + Intergenic
1127464091 15:59227014-59227036 CCCGGCCTCAGCCTGCCTGCAGG - Intronic
1129459645 15:75694108-75694130 TTCAGCCTCAGCCTGCGTGGTGG - Intronic
1129467191 15:75730825-75730847 CACAGCCTCAGACCTCCTGGAGG - Intergenic
1129691640 15:77717345-77717367 CCCCACCTCTGCCCGCCTGGGGG - Intronic
1129720037 15:77872894-77872916 CACAGCCTCAGACCTCCTGGAGG + Intergenic
1131075404 15:89492291-89492313 CCTAGACTCAGCCAGCCTGGTGG - Intronic
1131199929 15:90388018-90388040 CTCAGCGTGAGCCCGATTGGAGG + Intergenic
1131854828 15:96582640-96582662 CACAGCCCCTGCCCGCCTGAGGG + Intergenic
1132384323 15:101389495-101389517 CTCAGTCTCTGCCCCCATGGTGG - Exonic
1132490728 16:229204-229226 CCCCGCCTCAGGCCGCCCGGCGG + Intronic
1132585929 16:705731-705753 CACAGCCTCAGCCTCCCCGGTGG - Exonic
1132592314 16:731391-731413 CACACCCTGAGCCCGCCAGGAGG + Intronic
1132855727 16:2043848-2043870 CTCAGCCCCCGCCCCCCAGGAGG + Intronic
1134168094 16:11946454-11946476 CTCAGCCTCAGCCTCCTTAGTGG - Intronic
1134600463 16:15529576-15529598 CTCAGCCTCTGTCCTCATGGAGG - Intronic
1135277826 16:21128582-21128604 CTCTGCCTCAGCCTCCCGGGTGG - Intronic
1136288937 16:29260132-29260154 CTCAGCCTCCCACGGCCTGGGGG + Intergenic
1136383290 16:29907018-29907040 CCCAGACCCAGCCCTCCTGGAGG - Exonic
1136911777 16:34149876-34149898 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1138226793 16:55302802-55302824 CACAGCCTCATCCCTCCTAGTGG + Intergenic
1139340411 16:66264603-66264625 CTCACTCTGAGCCAGCCTGGAGG + Intergenic
1139851297 16:69952668-69952690 CGCAGCCCCAGCCGGGCTGGTGG - Intronic
1139880277 16:70175580-70175602 CGCAGCCCCAGCCGGGCTGGTGG - Intronic
1140372233 16:74419937-74419959 CGCAGCCCCAGCCGGGCTGGTGG + Intronic
1140514415 16:75531824-75531846 TTCAACCTCAGCAAGCCTGGTGG - Intronic
1141093703 16:81148110-81148132 CTCAACCTCAGCTAGCCTGGGGG - Intergenic
1141424092 16:83934404-83934426 CCCAGCCCCAGCCCCCCTCGGGG + Intronic
1141435140 16:83995799-83995821 CTCAGCCTCATCCCTGCAGGAGG - Intronic
1141629136 16:85277270-85277292 CCCAGCCTGGGCCCGTCTGGAGG - Intergenic
1141716512 16:85730082-85730104 CACAGCCTCAGAGCCCCTGGGGG + Intronic
1142205406 16:88780437-88780459 CTCTGCCTTAGCCTGCCTGGAGG - Intronic
1142744832 17:1950734-1950756 CTCAGCCTCAGCCTCCCAAGTGG - Intronic
1142972786 17:3623959-3623981 GTCAGCATCACCCCGCCTGCTGG - Intronic
1143372484 17:6449060-6449082 CTGAGCCTCAGCTCTCCAGGTGG - Intronic
1143429090 17:6866358-6866380 CTCAGCTTCAGCCGGCGAGGTGG - Intergenic
1143627323 17:8118028-8118050 CGCAGCAGCAGCCGGCCTGGAGG + Exonic
1143648674 17:8248935-8248957 CTCAAACACAGCCCGCCTGGTGG + Intronic
1144129815 17:12235356-12235378 CTGAGCCTCCTCCCTCCTGGGGG + Intergenic
1144831386 17:18133203-18133225 CTCAGCCTCTGCCCTCATGCAGG + Exonic
1145972426 17:28964222-28964244 GTCTGCCTCAGTCTGCCTGGAGG + Intronic
1146306428 17:31733236-31733258 CTCAGACTCTCCCAGCCTGGGGG - Intergenic
1147134675 17:38428264-38428286 CTCTGCCTCAGCCCGGTTGCAGG + Intergenic
1147390607 17:40106962-40106984 CTCAGGCTGAGCCGGCCGGGCGG - Intergenic
1147560827 17:41507874-41507896 CACAGCCTCTGCCCGCTTAGCGG + Intergenic
1148051604 17:44772431-44772453 CTCAGCCTCGGCCGGTTTGGAGG - Exonic
1148854577 17:50571770-50571792 CTCAGCCTCAGAGTCCCTGGTGG + Intronic
1149864701 17:60144839-60144861 TCCAGCCTCAGCCCCCCAGGTGG + Intergenic
1149943697 17:60898936-60898958 CCCAACCTCAGACCCCCTGGAGG + Intronic
1151493179 17:74444506-74444528 CACAGCCTCTGCCAGCCGGGAGG - Intronic
1152217875 17:79045003-79045025 CTCGGCCTCAGAGCTCCTGGAGG - Intronic
1152719335 17:81915203-81915225 CTCAGCCTCAGAGCTGCTGGTGG - Intronic
1152786248 17:82249482-82249504 CACAGCCTCCGGCCGCCTGCGGG - Exonic
1153576066 18:6523161-6523183 CTCACCCACAGACCACCTGGTGG + Intronic
1155054030 18:22169814-22169836 AGCCGCCTCAGCCCGCCCGGAGG - Intronic
1156452711 18:37275517-37275539 CTCGGCCTCCTCCCGCCTGCAGG + Intronic
1156482590 18:37445518-37445540 CTCAGCCCCAGGCTGTCTGGCGG - Intronic
1157157316 18:45280641-45280663 CTGACTCTCAGCCCTCCTGGAGG + Intronic
1157289692 18:46400687-46400709 CTCAGACTCAGACAGCCTGTCGG + Intronic
1158938260 18:62384589-62384611 CTCCGCCTCAGTGGGCCTGGAGG + Intronic
1159941302 18:74410984-74411006 CTCTGCCTCCACCTGCCTGGAGG - Intergenic
1160817480 19:1042840-1042862 CTCATCCTCAACCCCCATGGAGG + Intronic
1160913182 19:1484058-1484080 CTCGGCCTCAGCCCCACTGGCGG - Exonic
1161052356 19:2171199-2171221 CTCAGCCTCAGGCTGTGTGGTGG + Intronic
1162797710 19:13095300-13095322 GTCACCCCCTGCCCGCCTGGGGG - Exonic
1162936385 19:13983647-13983669 CTAAGCCTGAGCCCCCCTGGAGG + Intronic
1163566002 19:18051871-18051893 CCCACCCCCAGCCCGCCCGGCGG + Intergenic
1165247034 19:34503691-34503713 TTCAGCTTGGGCCCGCCTGGTGG + Exonic
1165349609 19:35268827-35268849 CTCCGCCTCCGCCCGCCCGCCGG - Intergenic
1165741543 19:38207828-38207850 ATCAGCCTCTGGCCCCCTGGAGG + Exonic
1166316847 19:41994121-41994143 CTGAGCCTGAGCCCGCCCCGAGG - Exonic
1166887783 19:45972495-45972517 CTCTGCCACAGCCCCCTTGGGGG + Intronic
1167326412 19:48828949-48828971 CTCTGCCTCAGCCTCCCTAGTGG - Intronic
1167390784 19:49193607-49193629 CTCAGCCCCAGCCTCTCTGGGGG - Intronic
1167713655 19:51127122-51127144 CTCAGGCTCAGCCTGGCAGGGGG - Exonic
1168338736 19:55611806-55611828 CTCACCCTCCGCCCACTTGGTGG + Intronic
1168643103 19:58042852-58042874 CTCAGCCACAGCGGCCCTGGTGG - Intronic
926748496 2:16179887-16179909 CACAGCCTCAGCCTCCCTGCAGG - Intergenic
927227686 2:20785781-20785803 CTCAGCTTCATCCAGCCTGCTGG + Intronic
929453554 2:42051466-42051488 CTCAGCCTCACGCTTCCTGGGGG + Intronic
929556132 2:42926753-42926775 CCCAGGCCCAGCCAGCCTGGAGG - Intergenic
929966895 2:46542966-46542988 CTCAGCCCCAGCCCGCCTGGGGG - Exonic
930024173 2:47020383-47020405 CTCAGCCTCAGCCGGCCAGGTGG - Intronic
931567276 2:63627876-63627898 CTGACCCTCTGCCCTCCTGGTGG + Intronic
932368154 2:71166306-71166328 CTGAGCCCCAGTCAGCCTGGAGG - Intergenic
932715789 2:74100179-74100201 CCCAGCCCCAGCCCCACTGGGGG - Intronic
934759259 2:96844473-96844495 TACAGCCTCAGCCCTCATGGTGG + Intronic
935311080 2:101784096-101784118 CTCAGCCGCAGCCACCATGGTGG + Intronic
937069438 2:119051838-119051860 CTCAGCCCCAGCCCTTCTGCGGG - Intergenic
938455651 2:131460918-131460940 CTCAGCCCCGGCCCGCCTGGGGG - Intergenic
938539322 2:132273351-132273373 CTCAGCCTCAGCCAGCCTCTGGG + Intergenic
938972990 2:136449180-136449202 CAGAGCCGCAGCCAGCCTGGGGG - Intergenic
939008693 2:136819690-136819712 TTCAGCCTCAGCTGGACTGGGGG - Intronic
941508361 2:166375867-166375889 CCCAGCCTCAGCCGAGCTGGCGG + Exonic
942271788 2:174282687-174282709 CTGAGCCACAGCCTGCTTGGAGG - Intergenic
944688251 2:202136730-202136752 CTGAGCCTCTGCTCGCCGGGAGG - Intronic
945381323 2:209145224-209145246 CTCAGCCCCAGCCAGCCATGGGG + Intergenic
946839294 2:223804207-223804229 CTCAGCCACTGCCTGGCTGGTGG - Intronic
947736304 2:232457253-232457275 GCCTGCCTCAGCCCGCCAGGAGG + Exonic
947765203 2:232633484-232633506 CTCAGCGACTGCCAGCCTGGTGG - Exonic
947983209 2:234427248-234427270 TTCAGGCTCTGCCTGCCTGGAGG - Intergenic
948171341 2:235906077-235906099 GTCAGCCACAGCCCCCTTGGAGG - Intronic
948836912 2:240630338-240630360 CACGGCCGCAGCCTGCCTGGGGG - Exonic
1169042821 20:2509622-2509644 CTCAGCCTCAGCCTCCCTCGGGG - Intronic
1171123202 20:22582880-22582902 CCCAGCCTGAGCCCGCTCGGGGG - Exonic
1171769451 20:29311176-29311198 CTCAGCCGCAGCCAGCCTCTGGG + Intergenic
1171907098 20:30908217-30908239 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1174196264 20:48774870-48774892 CACAGCCTCAGCCTGCCATGGGG + Intronic
1175789298 20:61731513-61731535 CTCTGCTTCACCCCACCTGGGGG - Intronic
1175941233 20:62538434-62538456 CCCAGCTTCAGCCTCCCTGGAGG + Intergenic
1176241229 20:64076819-64076841 CTCTGCCTCTGCTCCCCTGGGGG - Intronic
1176551800 21:8226360-8226382 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1176570709 21:8409359-8409381 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1176578618 21:8453506-8453528 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1177253742 21:18632118-18632140 CTCAGTCTCAGCCAGACTTGAGG + Intergenic
1178392708 21:32212480-32212502 TTCAGTTTCAGCCCTCCTGGAGG - Intergenic
1178580079 21:33831164-33831186 ATCAGCCTCAGACTGCCAGGCGG + Intronic
1179359232 21:40689960-40689982 CTCAGCCCCAGCCAGTGTGGAGG + Intronic
1179453940 21:41485536-41485558 CCCAGCCTCAGCCCCCCAAGTGG - Intronic
1179896417 21:44366065-44366087 TTCAGACACAGCCCGCCTAGCGG + Intronic
1180314875 22:11269548-11269570 CTCAGCCGCAGCCAGCCTCTGGG + Intergenic
1180340504 22:11614155-11614177 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1180568917 22:16697955-16697977 CTCAGCCTCGGACAGCCTGGAGG + Intergenic
1181639751 22:24190307-24190329 CTCAGCCCCACCATGCCTGGAGG - Intergenic
1183096512 22:35555268-35555290 TTCAGCCTCTGCCTACCTGGGGG + Intergenic
1183414906 22:37676435-37676457 CCCAGCCACAGCCCGACTGCAGG + Intronic
1183483804 22:38078693-38078715 CTCCTCCCCAGGCCGCCTGGTGG - Exonic
1183505882 22:38208666-38208688 CTCAGCCTCTCCCTGTCTGGTGG + Intronic
1183828945 22:40407987-40408009 CACTGCCTCAGCCTGCCTGCAGG + Intronic
1184477814 22:44730853-44730875 CTCAGCCTCTGTCTGCTTGGTGG + Intronic
1184502106 22:44880496-44880518 CTCTGCCTGAGCCCTCCTGGGGG - Intergenic
1184558808 22:45249065-45249087 CTCAGAATCAGCCCCCTTGGAGG + Intergenic
1184834765 22:47014644-47014666 CTCAGCCTCAGCATCCCTGTTGG - Intronic
1184842224 22:47058714-47058736 CTGGGCCTCAGCGAGCCTGGTGG - Intronic
1185288709 22:50013715-50013737 CACAGCCTCTCCCAGCCTGGGGG - Intergenic
1203256822 22_KI270733v1_random:143282-143304 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
950046051 3:9949231-9949253 CTCAGCGCCAGCCCTCTTGGGGG + Exonic
950883960 3:16346832-16346854 CTCATCCTCAGCCTGTCTGCAGG - Intronic
951825131 3:26859857-26859879 CTCCGCCCCAGTCCTCCTGGAGG + Intergenic
952990930 3:38830031-38830053 CTCAGCCTCTGCAAGCCTGTAGG - Intergenic
954443317 3:50533552-50533574 CTCAGCCTCCCCCTGCCAGGAGG - Intergenic
954641912 3:52105770-52105792 CTCATGCTCAGGCTGCCTGGAGG - Intronic
955769249 3:62372553-62372575 CTCCGCCGCCGCCCGCCCGGAGG + Exonic
956128322 3:66032319-66032341 CTCTGCCTCAGCCTCCCTAGTGG + Intronic
960988272 3:123294546-123294568 CTCAGGCTGAGCCTTCCTGGAGG - Intronic
961501314 3:127338022-127338044 CGCAGCTGCCGCCCGCCTGGCGG - Intergenic
965757805 3:172041964-172041986 CTCATTCTCAGCCAGCCTGTGGG - Intronic
967188299 3:186964055-186964077 TTCAGCCTCAGCCCGTTGGGAGG + Intronic
967220371 3:187243100-187243122 CTCAGCCTCAGACCACATGAAGG + Intronic
967820205 3:193833019-193833041 ATCAAGCTCAGCCTGCCTGGAGG - Intergenic
968582720 4:1402484-1402506 CTGAGCCTCAGCCAGCTTGGCGG + Intergenic
968601891 4:1513406-1513428 CGCTGCCGCAGCCCGCCTGGAGG + Intergenic
969308587 4:6339457-6339479 AGAAGCCTCAGCCAGCCTGGGGG + Intronic
969708817 4:8831099-8831121 CTCAGCCTCAGGCCCCCCTGTGG - Intergenic
971231469 4:24803448-24803470 CTCAGCCTCCGCTTGCCCGGTGG + Intergenic
975110977 4:70626279-70626301 CTCTGCCTCACCCAGGCTGGAGG + Intergenic
976731622 4:88267601-88267623 CTCAGCCTCTACTTGCCTGGTGG + Intronic
978251136 4:106632600-106632622 CAAAGCCTCAGCCAACCTGGAGG - Intergenic
981938960 4:150261400-150261422 AACAGACTCAGCCCGCCTGATGG - Intergenic
983491914 4:168398697-168398719 CTCAGACTCAGCCAGACTTGAGG + Intronic
985745681 5:1645495-1645517 CTCAGCCTCAGTGATCCTGGCGG + Intergenic
986337769 5:6767865-6767887 TTAGGCCTCAGCCCGCATGGGGG + Intergenic
987671008 5:21008440-21008462 CTCAGCCTCTGTTTGCCTGGTGG - Intergenic
988532063 5:32036625-32036647 CTCAGCCCCAGGCACCCTGGAGG - Intronic
990981077 5:61602856-61602878 CTCAGCCTCAGACCTCCCAGGGG - Intergenic
992001262 5:72438570-72438592 CAAAGCCTCAGCCAGCATGGTGG - Intergenic
993826228 5:92690279-92690301 CTCAGCGTCCCCCCGCGTGGCGG - Intergenic
997381622 5:133442097-133442119 CTCATCCTCACTCCTCCTGGAGG - Intronic
1000135945 5:158351046-158351068 TTCAGCCTCAGCCTCCCTAGTGG - Intergenic
1001382064 5:171311660-171311682 TTCCCCCGCAGCCCGCCTGGGGG - Exonic
1002066524 5:176654712-176654734 CTCTGCCTCCACCAGCCTGGAGG + Intronic
1002860893 6:1078499-1078521 CTCGGGCTCAGCCCATCTGGAGG + Intergenic
1004161957 6:13221923-13221945 CTCTGCCTCAGCCTCCCAGGTGG - Intronic
1006235962 6:32632765-32632787 ATAAGCCTCAGCCCGCCTGCCGG + Intronic
1006608138 6:35274297-35274319 CTCTGCCTCAGCCAGCCCAGAGG - Intronic
1007219214 6:40265217-40265239 GACAGTCTCAGCCAGCCTGGTGG - Intergenic
1007243029 6:40440754-40440776 CTGAGGCTCAGCCCTCCTAGGGG - Intronic
1007778017 6:44234545-44234567 CTCGGCCTCTTCCTGCCTGGTGG - Intergenic
1009651371 6:66481015-66481037 CTCAGTCTCAGACCGAGTGGAGG + Intergenic
1012398840 6:98828105-98828127 CCTAGCCTCGGCCCGCGTGGGGG - Intergenic
1014601482 6:123418564-123418586 CTCACCCTCAGCTCCCATGGAGG + Intronic
1015767321 6:136732312-136732334 TTCAGCCTCAGCCTCCCTAGTGG - Intronic
1018542601 6:164898613-164898635 CTCAGTCCCAGCCAGTCTGGAGG - Intergenic
1018768446 6:166952317-166952339 CTCACACACAGCCCTCCTGGAGG + Intronic
1019276910 7:180468-180490 CTCGGCCTCAGCCTCCCTGGGGG + Intergenic
1019349948 7:549965-549987 CTCAGCCTCATCTCCCCTGGGGG + Exonic
1020120444 7:5500376-5500398 CCCAGCCTCTGCACTCCTGGAGG + Intronic
1022097533 7:27150389-27150411 CTCCACCTCTGCCAGCCTGGAGG + Intronic
1022516672 7:30979159-30979181 CTGAGCTTCTGCCAGCCTGGAGG + Exonic
1023627399 7:42129698-42129720 CTCTGCCTCAGCCTCCCTAGTGG - Intronic
1024813389 7:53239296-53239318 TTCGGACTCAGCCCGCCTGCAGG - Intergenic
1024984359 7:55182537-55182559 CCCAGCAACAGCCTGCCTGGTGG - Intronic
1025110111 7:56209345-56209367 CTCGGCATCAGCACCCCTGGAGG + Intergenic
1026307782 7:69156799-69156821 CTCAGCATCAGCACCCCTGGAGG - Intergenic
1026446422 7:70488404-70488426 CTTGGCCTCAGACCGACTGGGGG - Intronic
1026513900 7:71049955-71049977 CTCAGCCAGAGCCTGCCTGGAGG - Intergenic
1032426969 7:131830244-131830266 CTCAGCCTCCCCTCGTCTGGGGG + Intergenic
1032534167 7:132646695-132646717 CTCAGTCTGAGCCCTACTGGTGG + Intronic
1035055311 7:156031340-156031362 CTCAGTCTCAGCCCAAGTGGGGG + Intergenic
1035273840 7:157735796-157735818 CTCAGCCACTGCCTGCCAGGAGG - Intronic
1036868747 8:12421408-12421430 CCCAGGCCCAGCCCTCCTGGAGG - Intergenic
1037966181 8:23135454-23135476 TTCAGGCTTGGCCCGCCTGGCGG - Intergenic
1038479994 8:27895288-27895310 CTGTGCCTCAGGCCGGCTGGGGG - Intronic
1038554086 8:28494440-28494462 CTCCGCCTCAGCCCGCGCCGAGG + Intronic
1039983668 8:42429763-42429785 CTCACCCTCAGCCAGCACGGGGG - Intronic
1042120344 8:65480499-65480521 CCCAGCCTCAACCAGCCAGGGGG - Intergenic
1043611756 8:82072754-82072776 CTCAACCTCAGCCAGCCTGAAGG - Intergenic
1048164321 8:132048903-132048925 CTCAGCCTCAGGCCCCCTGCAGG - Intronic
1048576399 8:135693539-135693561 CCCAGCCTCAGAGCTCCTGGTGG - Intergenic
1049268232 8:141680920-141680942 CTCAGCCTTTGCTGGCCTGGGGG + Intergenic
1049378135 8:142298731-142298753 CTCAGGCTCAGCCCTCCCTGTGG - Intronic
1049427251 8:142542990-142543012 CCCAGCCTCAGTCAGCCTGTAGG + Intronic
1049674341 8:143883107-143883129 CTCATCCCCAGCAGGCCTGGAGG - Intergenic
1054293443 9:63317488-63317510 GTCAGCCTCAGCCCGACTCAGGG + Intergenic
1055332307 9:75197167-75197189 CTCACCCTCACCCCCCGTGGGGG + Intergenic
1056413384 9:86354192-86354214 CTCAGCCTCTGCCGGCCTGGGGG + Intronic
1056852495 9:90096259-90096281 CTGAGTCACAGCCCCCCTGGGGG - Intergenic
1057212036 9:93205630-93205652 CTCAGCCTCATCCCGTGGGGAGG + Intronic
1059329112 9:113524045-113524067 GTCAGGCTGAGCCCGCCTGGAGG - Intronic
1059468282 9:114483536-114483558 CTGAGGCTCAGGCCACCTGGGGG + Intronic
1060004953 9:119991795-119991817 CTCAGCCACAGCTCTCCTGCAGG + Intergenic
1060406346 9:123374911-123374933 CCCAGCCTCAGCCCGCCTGTGGG + Intronic
1061725587 9:132580476-132580498 CTCACCCCCAGCCCGGCCGGCGG + Intergenic
1062029762 9:134356924-134356946 CCCAGCCTCAGCAGCCCTGGAGG + Intronic
1062030725 9:134360798-134360820 CCCAGCTTCAGCCTGCCTGGGGG - Intronic
1062309927 9:135930114-135930136 GTCAGCCTCAGCCCAGCTGTGGG - Intergenic
1203472979 Un_GL000220v1:124964-124986 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1203363183 Un_KI270442v1:235561-235583 CTCAGCCGCAGCCAGCCTCTGGG + Intergenic
1185543192 X:920517-920539 CTCAGCCTCGACCCGCACGGCGG + Intergenic
1187097917 X:16166700-16166722 CTCAGCCTCAGCCCTGCCTGTGG - Intergenic
1187698116 X:21940920-21940942 CCCCGCCCCAGCCCGCCAGGCGG - Intronic
1192168925 X:68842593-68842615 CCCTGCCTCAGGACGCCTGGAGG + Intergenic
1199719673 X:150533733-150533755 CACGGCCTCAGCCCTCATGGAGG + Intergenic
1200059312 X:153477183-153477205 CTCTGGCACAGCCAGCCTGGAGG - Intronic
1200120691 X:153788919-153788941 CTCGGCTGCAGCCAGCCTGGAGG - Intronic
1201075144 Y:10181228-10181250 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic