ID: 1116817905

View in Genome Browser
Species Human (GRCh38)
Location 14:49599913-49599935
Sequence GGGCTCAGCCTCAGCCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 2, 2: 4, 3: 34, 4: 322}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116817905_1116817922 3 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817922 14:49599939-49599961 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
1116817905_1116817918 -1 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
1116817905_1116817915 -7 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817915 14:49599929-49599951 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
1116817905_1116817920 1 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817920 14:49599937-49599959 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
1116817905_1116817919 0 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817919 14:49599936-49599958 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
1116817905_1116817921 2 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817921 14:49599938-49599960 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
1116817905_1116817912 -10 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817912 14:49599926-49599948 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
1116817905_1116817925 17 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817925 14:49599953-49599975 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
1116817905_1116817924 14 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817924 14:49599950-49599972 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
1116817905_1116817927 21 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817927 14:49599957-49599979 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
1116817905_1116817914 -8 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817914 14:49599928-49599950 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
1116817905_1116817913 -9 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817913 14:49599927-49599949 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
1116817905_1116817928 25 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817928 14:49599961-49599983 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116817905 Original CRISPR GGGCTCAGCCTCAGCCCGCC TGG (reversed) Intronic
900080235 1:851341-851363 GGGCTGAGTCTCAGCCAGCAGGG + Intergenic
900242793 1:1624951-1624973 TGGCTCAGCCTTAGCCTGCTGGG + Intronic
900300492 1:1974452-1974474 GGACACAGCCTCAGGCCGGCAGG - Intronic
900368854 1:2322655-2322677 GGGCTCTTCCTCCGCCCGCCAGG - Intronic
900573139 1:3369593-3369615 GAGCTCAGCCACAGTCCGGCTGG - Intronic
901006088 1:6172121-6172143 TGGCTCAGCCTAGGCCAGCCTGG - Intronic
901209424 1:7516027-7516049 GGGCTCTGCATCAGCCTTCCTGG + Intronic
901230136 1:7637206-7637228 GGGCACAGCCTGGGCCAGCCTGG - Intronic
901414667 1:9108407-9108429 AGGGTCAGCCTCAGCCCCGCAGG + Intronic
901454041 1:9353176-9353198 GAGAGCCGCCTCAGCCCGCCCGG + Intronic
902864414 1:19268977-19268999 GGACTCAGCCCCAGGCCTCCTGG + Intergenic
902866640 1:19284392-19284414 GGACTCAGCCCCAGGCCTCCTGG + Intronic
903422067 1:23225199-23225221 AGGCTCAGCCTCACCCCATCTGG - Intergenic
903694032 1:25194535-25194557 TGGCTCAGACTCAGCCCTGCTGG + Intergenic
903961235 1:27059078-27059100 GGGCTCAGCCTCAGCATCCTTGG + Intergenic
904460970 1:30679641-30679663 GGGCACAGTCACAGCCCGGCTGG + Intergenic
905151397 1:35930917-35930939 GGGCTCGGCCGTACCCCGCCGGG - Intronic
905169725 1:36102374-36102396 GGGCACAGCCTCGGCCTCCCGGG + Intronic
905392220 1:37644095-37644117 GGGCTCAGCATGAGGCTGCCTGG - Intergenic
905703858 1:40040086-40040108 TGGGTCAGCCCCAGCCCGGCTGG - Intergenic
905850226 1:41268466-41268488 GCCCTCATCCTCAGCCCACCAGG - Intergenic
906033176 1:42735981-42736003 GGGCTGGGCCTCAGCTGGCCTGG - Exonic
906209060 1:44002280-44002302 GGGGGCAGCCTCAGCCCAGCAGG + Intronic
906611756 1:47208709-47208731 GGGCTCAGCCAGAGCCCGGCTGG - Intergenic
906678575 1:47709933-47709955 ATGCTCAGCCCCACCCCGCCCGG - Intergenic
907308143 1:53525002-53525024 GTACTCTGCCTCAGCCAGCCCGG + Intronic
909789942 1:79663525-79663547 GGGCTCAGTATCAGGACGCCTGG - Intergenic
910759222 1:90718585-90718607 GCGCTCGGGCTCAGCCCGGCGGG + Intergenic
912560343 1:110547137-110547159 GGGCTCAGACCCAGACTGCCTGG - Intergenic
913269375 1:117078029-117078051 TGGCTCACCTTCAGCCCGGCGGG - Exonic
914803178 1:150974807-150974829 GGGCTCGGGCTCAGCTCGACTGG - Exonic
914884886 1:151576726-151576748 GGGTTCAGCCTCAGCCTCCCAGG + Intronic
915163202 1:153933740-153933762 GGGCTGAGCCTGAGCCCCCTGGG + Exonic
915355722 1:155254470-155254492 GGGCACAGGCTCAGCCTGGCAGG + Intronic
917991309 1:180381999-180382021 TGCCTCAGCCTCAGCCTCCCTGG - Intronic
917997564 1:180456803-180456825 AGCCTCAGCCTCAGCCTCCCGGG + Intronic
920156527 1:203956479-203956501 GGGGTCAGGCTCAGCCCTTCGGG - Intergenic
920438034 1:205960805-205960827 CTACTCAGCCTCAGCCAGCCTGG - Intergenic
922573631 1:226647828-226647850 GGCCTAAGGCTCAGCCCACCTGG + Intronic
1063392988 10:5662103-5662125 GGGCTCATCCTCAGCTCTCAGGG + Intronic
1065579147 10:27154270-27154292 GGGCTCAGCGCCTCCCCGCCGGG - Exonic
1065625598 10:27625679-27625701 GGGCTCAGCGCAAGCCAGCCTGG - Intergenic
1066354273 10:34666597-34666619 CGCCTCACCCTCAGCCCTCCAGG + Intronic
1067038149 10:42934017-42934039 GAGCTCAGCATCAGCGCTCCTGG + Intergenic
1068845051 10:61662846-61662868 GGCCCGAGCCTCTGCCCGCCGGG - Intergenic
1070544071 10:77438998-77439020 GGGCTCGGCCTCGGCCTCCCGGG - Intronic
1070795053 10:79211462-79211484 GGTGTCAGCCTGAGCCCTCCAGG + Intronic
1073143310 10:101262916-101262938 GGCCTCTGCTTCAGCCCACCTGG + Intergenic
1073327555 10:102651330-102651352 GGGCTGAGCCCCACCCCCCCAGG + Intronic
1074772432 10:116742630-116742652 GGGCCCCGCCCCGGCCCGCCCGG + Intergenic
1074891134 10:117737479-117737501 GGACACAGCCTCAGCCCTCTTGG + Intergenic
1075901021 10:126042998-126043020 GTGCTCAGCCTCCTCCCACCGGG + Intronic
1076148417 10:128143613-128143635 GGCCACAGCCTCAGACAGCCAGG - Intergenic
1076193470 10:128498989-128499011 TGGGCCAGCCTCAGCCCTCCAGG - Intergenic
1076840730 10:133043928-133043950 GGGCTCAGCTTCAGGCCCCAGGG - Intergenic
1077371123 11:2182121-2182143 AGCCTCAGCCTCAGCCAGTCCGG + Intergenic
1077672059 11:4166287-4166309 GAGCTCAGCCTCAGCCATCCAGG - Intergenic
1077867493 11:6234926-6234948 GGGCTCCGCCTCCGCCCTGCCGG - Intronic
1079003314 11:16775428-16775450 TGGCTCAGGCTCAGCCAGACAGG - Intergenic
1081621546 11:44621844-44621866 GAGCCCACCCTCAGCCTGCCAGG - Intergenic
1081670868 11:44941827-44941849 GCGCTCAGCCACTGCCCACCAGG + Intronic
1081998256 11:47378103-47378125 GGGCCTGGCCTCAGCCCGCCAGG + Intronic
1083701161 11:64478502-64478524 GGCCTCAGCCTCATCCCACTGGG + Intergenic
1083713196 11:64561124-64561146 CGGTTCAGACTCAGCCGGCCTGG + Intronic
1083765778 11:64840779-64840801 GGGCTCAGTCGCAGCCAGACAGG - Intronic
1084556416 11:69878803-69878825 GGGCACAGCCTCAGCCCTATAGG + Intergenic
1085041318 11:73328118-73328140 GGGCTCTTCCTCAGCCAGCTAGG - Intronic
1085199595 11:74693705-74693727 GGCCTCAGCCTCACTCTGCCAGG + Intergenic
1085453949 11:76655464-76655486 GTGCTCAGCATGGGCCCGCCCGG + Intergenic
1085640328 11:78189086-78189108 GGGCCCAGCCTCGTCCTGCCCGG + Exonic
1091006080 11:131955168-131955190 AGCCTCAGCCTCAGCCCGCTTGG + Intronic
1091448531 12:558647-558669 GGGCTCACCCTCAGGCCACTGGG - Exonic
1091605763 12:1949916-1949938 GGGCTGAGCAACAGGCCGCCCGG - Intronic
1091837057 12:3593425-3593447 GGGCCCAGCCACAGCACGCCAGG - Exonic
1095949300 12:47773270-47773292 GCGCTCGCCCTCGGCCCGCCCGG + Exonic
1096270739 12:50164399-50164421 GGTCTCAGCCTCACCCAGGCTGG - Intronic
1097127988 12:56789493-56789515 GGGGTCAGCCCCCCCCCGCCCGG - Intergenic
1101330822 12:103756601-103756623 GGGCTCAATCTCAGACTGCCTGG + Intronic
1101371867 12:104137985-104138007 GGGCCCGGCCTCGGCCCGCGCGG + Intronic
1101575279 12:105991518-105991540 GGGTTCAGACTCAGCTGGCCAGG + Intergenic
1102651754 12:114447434-114447456 GGGCGCAGCCGGAGACCGCCCGG + Intergenic
1103600186 12:122049937-122049959 GTTCTCAGCCTCAGCACCCCTGG + Intronic
1103741460 12:123094396-123094418 GGGCTCCGCTTCAGCCTGCTGGG - Intronic
1103951083 12:124551557-124551579 GGGCTAAGGCTCGGCCGGCCTGG + Intronic
1104568298 12:129903954-129903976 GGCCGCCGCCTCGGCCCGCCCGG + Intergenic
1104931940 12:132344404-132344426 AGGCTCAGCATCTGCCCGCGCGG - Intergenic
1105013763 12:132773599-132773621 TCGCTCAGCCTCAGGCTGCCAGG + Intronic
1106160065 13:27193512-27193534 GGGCTCAACCTCCGCCTCCCAGG - Intergenic
1106193626 13:27475255-27475277 AGGCTCAGCCCCAGCCCACCTGG + Intergenic
1106498641 13:30306870-30306892 GCGCTCAGCCCCACCCCGGCTGG - Intronic
1108308846 13:49165900-49165922 GGGCTCAATCTCAGGCCACCAGG + Intronic
1108708963 13:53015018-53015040 GGGCCCTGCCTCAGCCCGGCAGG + Intergenic
1110848442 13:80217061-80217083 TGCCTCAGCCTCAGCCTCCCGGG + Intergenic
1113577953 13:111407567-111407589 GGGCCCAGCCTGAGCCCATCTGG - Intergenic
1113598107 13:111548486-111548508 GGGCTCAGCCACAACCCGGGAGG - Intergenic
1114174280 14:20305725-20305747 GGGTGCAGCCGCAGCCAGCCAGG - Intronic
1114427970 14:22637906-22637928 GGGGTCAGCCCCCGCCCGGCCGG + Intergenic
1116656908 14:47665478-47665500 GGCTCCAGCCTCAGCCAGCCCGG - Intronic
1116817905 14:49599913-49599935 GGGCTCAGCCTCAGCCCGCCTGG - Intronic
1118769326 14:68931319-68931341 GGGCTCTGCCTCTGTCTGCCAGG - Intronic
1120392335 14:83924533-83924555 AGGCCCAGCCTCAGGCCCCCAGG - Intergenic
1121242323 14:92439778-92439800 GGGCCCACCCCCACCCCGCCAGG + Intronic
1122151542 14:99728629-99728651 GGGCTCAGCCTCCAGCCACCTGG + Intergenic
1122348792 14:101076190-101076212 GGACTCAGCCTCTGCACCCCGGG - Intergenic
1122597422 14:102903084-102903106 GGGCTCTGCATCAGGCCTCCTGG - Intronic
1122602629 14:102929190-102929212 GGGCCCACGCTCAGCGCGCCCGG - Exonic
1122823391 14:104358275-104358297 GGGCACAGACTCAGCGTGCCAGG + Intergenic
1123091912 14:105745695-105745717 AGGCTCAGCCTCAGGGAGCCAGG - Intergenic
1125500687 15:40238882-40238904 AGGCTCACCCTGAGCCCGGCAGG + Intronic
1125834695 15:42738552-42738574 GGGCACTGCCTCACCCCTCCTGG - Intergenic
1127274851 15:57433474-57433496 GGTCTAACCCTCAGCCAGCCCGG - Intronic
1127500152 15:59547541-59547563 GGGATGAGCCTCAGCACCCCAGG + Intergenic
1128657004 15:69469839-69469861 GGTCACAGCCTCAGGCTGCCTGG + Intergenic
1129467192 15:75730828-75730850 GGACACAGCCTCAGACCTCCTGG - Intergenic
1129893755 15:79089385-79089407 AGGCTCACCCCCACCCCGCCCGG + Intronic
1130787302 15:87114537-87114559 GGGCCCAGCCGGAGACCGCCAGG + Intergenic
1132022309 15:98373247-98373269 GGGCTCAGCACCAGCCAGCAAGG - Intergenic
1132353986 15:101158020-101158042 GGGCTCAGGCTGAGGCCCCCAGG + Intergenic
1132468036 16:86614-86636 GGGCTCAGCCTCAGCACGGGGGG + Exonic
1132490725 16:229201-229223 GGCCCCCGCCTCAGGCCGCCCGG + Intronic
1132585930 16:705734-705756 GGGCACAGCCTCAGCCTCCCCGG - Exonic
1132700571 16:1220441-1220463 GGGCTCGGCCTCAGGGCCCCAGG - Exonic
1132821243 16:1872260-1872282 GCGCTCAGACTCAGCCCTCGGGG + Intronic
1133230035 16:4362067-4362089 GGGCTCAACCTCACCACACCTGG - Exonic
1133335562 16:5004604-5004626 GGGGTCAGCCTCAGCCTCCTGGG + Intronic
1134300321 16:12984945-12984967 GGCCTCAGCCTAATCCCGTCGGG - Intronic
1136383292 16:29907021-29907043 GGGCCCAGACCCAGCCCTCCTGG - Exonic
1136447892 16:30335199-30335221 GGGTTCCGCCTGAGCCCGCAGGG + Intergenic
1136777571 16:32879941-32879963 GGGCTCGGCCTGAGCTAGCCTGG - Intergenic
1136893053 16:33981573-33981595 GGGCTCGGCCTGAGCTAGCCTGG + Intergenic
1137792293 16:51185335-51185357 GGGCTCAGCCTCAGCTTCCACGG + Intergenic
1138439618 16:57026270-57026292 GTGCTCGCCCTCAGCCCCCCTGG + Exonic
1139871850 16:70114396-70114418 GCGCTCAGCTACAGCCCGGCGGG - Exonic
1140364078 16:74368087-74368109 GCGCTCAGCTACAGCCCGGCGGG + Intergenic
1141701231 16:85643018-85643040 AGGCTCAGGCCCACCCCGCCAGG - Intronic
1142148320 16:88501867-88501889 GGGATCAACCCCAGCCCGCGAGG + Intronic
1142178291 16:88655166-88655188 GAGCGCAGCCTCTGCCCTCCCGG + Intronic
1203079985 16_KI270728v1_random:1142050-1142072 GGGCTCGGCCTGAGCTGGCCTGG - Intergenic
1143096907 17:4483082-4483104 CTGCTCAGCCTCTGCCCCCCAGG + Intronic
1143517509 17:7427154-7427176 GGGCTGAGGCTCTGCCCGCCTGG + Exonic
1143619889 17:8074724-8074746 GGCCTCAGCCTCAGCCCATTGGG + Intronic
1143622306 17:8087652-8087674 GGGCTCCGCCTGGGCCTGCCCGG - Exonic
1143888875 17:10087173-10087195 GAGTTCAGCCTGAGCTCGCCGGG + Intronic
1144768498 17:17746033-17746055 GGGCTCAGCCCCTGCCTACCAGG + Intronic
1146185658 17:30722561-30722583 GGGCCCAGCCTCAGCTTGGCAGG - Intergenic
1146277681 17:31525555-31525577 GGGCTCTGGCTCAGTCCACCAGG - Intronic
1147382236 17:40062842-40062864 GGGCTCGGGCTCGGCGCGCCCGG - Exonic
1147888275 17:43699038-43699060 GGGCTCAGCTTGTGCCTGCCTGG + Intergenic
1148485345 17:47987376-47987398 GGGCTCAGGCTCTGCCAGGCGGG - Intergenic
1148748121 17:49929730-49929752 GGGCTCAGTCTCATGCAGCCTGG + Intergenic
1150779504 17:68109218-68109240 GCACTCAGCCTCAGCCTGCCTGG + Intergenic
1151363594 17:73603308-73603330 GGGGCCAGCCTCTGCCCGCATGG - Intronic
1151685393 17:75643274-75643296 GGCCTCAGCCTCAGCCGCCCTGG - Intronic
1152307615 17:79530466-79530488 GGGCTCAGCGACAGCTCACCCGG + Intergenic
1152532056 17:80924519-80924541 CTGCTCAGCCCCAGCCCACCTGG + Intronic
1152598536 17:81249905-81249927 AGGCTCAGCCACAGCCCCTCAGG - Intronic
1152640425 17:81447147-81447169 GGGCCCAGCCTGAGCCCACAAGG + Exonic
1152657361 17:81526200-81526222 GGGCTCCTCCTCAGCCTGGCTGG + Intergenic
1152805044 17:82351716-82351738 TGGCCCGGCCTCAGCCCACCCGG + Intergenic
1152942361 17:83179465-83179487 GGCCACATCCTCAGCCCCCCCGG + Intergenic
1154115256 18:11608757-11608779 GGGGTCAGCCCCCGCCCGGCCGG + Intergenic
1154132482 18:11749588-11749610 AGGCTCAGCCTCCGCCCTCAAGG + Intronic
1154332926 18:13444328-13444350 GGGCTTAGCCCCTGCACGCCTGG - Intronic
1155052969 18:22164588-22164610 GGGCAGAGCCTCAGCCCAGCTGG + Intergenic
1155054031 18:22169817-22169839 GGGAGCCGCCTCAGCCCGCCCGG - Intronic
1158953783 18:62522304-62522326 GCGCTCACCCTCGGCCGGCCGGG + Intergenic
1160120514 18:76126505-76126527 GGGATCAGCCTCAGCTTGGCAGG + Intergenic
1161011002 19:1959443-1959465 GGGCTCAGCCGCAGCCTGTAGGG - Intronic
1161061405 19:2217004-2217026 GGGCTCAGCTTCATGCTGCCAGG - Exonic
1161435259 19:4259036-4259058 GGACACAGCCTCAGGCCTCCTGG + Intronic
1161486788 19:4540136-4540158 GGGCTGAGCCTAAGCCAGGCAGG + Exonic
1162421792 19:10569601-10569623 TGGCTCAGTCTGAGCCCGGCAGG - Intergenic
1162461933 19:10818538-10818560 GGGCTCAGCCTCAGGGCGTTAGG - Intronic
1162797713 19:13095303-13095325 GGGGTCACCCCCTGCCCGCCTGG - Exonic
1163469615 19:17488807-17488829 GGTCCCAGCCTCTGCCCTCCCGG + Intronic
1163594578 19:18213571-18213593 TGGCTCAGACTCAGCCCTCTGGG + Intronic
1163727200 19:18929446-18929468 GGGCGCAGCCTCAGCCAGGCGGG + Exonic
1164609486 19:29622403-29622425 GGGCTCAGCCTCTCCAGGCCAGG - Intergenic
1165096116 19:33410811-33410833 GGGCTCAGCCACAGCCACGCAGG - Intronic
1165463389 19:35958084-35958106 GGGCTCAGCCTCAGAGCCCAGGG - Intergenic
1166930595 19:46299073-46299095 GGCCTCACCCTGAGCCCGCCAGG + Intronic
1167390787 19:49193610-49193632 GGGCTCAGCCCCAGCCTCTCTGG - Intronic
1168348815 19:55664070-55664092 GGGCTCAGTCTGTGCCCGTCGGG + Intronic
1168351851 19:55680511-55680533 GGGTTCAGCCTCAGTTCCCCGGG + Intronic
925339375 2:3125735-3125757 GGGCCCTGCCTCAGCCCCCTGGG + Intergenic
926691078 2:15734034-15734056 GGGCCCAGACTCAGGCCGTCTGG + Intronic
926718265 2:15941238-15941260 GGGCTCAGCCTCTCCCTCCCTGG + Intronic
929188821 2:39121157-39121179 GAGCGCAGCCACAGCCCGGCCGG - Intronic
929966898 2:46542969-46542991 GGGCTCAGCCCCAGCCCGCCTGG - Exonic
930024174 2:47020386-47020408 CAGCTCAGCCTCAGCCGGCCAGG - Intronic
931127402 2:59293209-59293231 GTGCCCAGCCTCAGACCACCTGG - Intergenic
932451400 2:71812963-71812985 GGGCCCATCCTCAGGCAGCCTGG - Intergenic
932497777 2:72155227-72155249 GGGCACAGCCTCCTCCCGCAGGG + Intergenic
934558438 2:95299810-95299832 GGGCTCTGCCTCAGCCCTCCAGG + Intronic
934563443 2:95324997-95325019 CAGCCCAGCCTCAGCCAGCCAGG - Intronic
934913648 2:98280575-98280597 GGCCTCAGCCTCATCCCAGCTGG - Intronic
935800590 2:106691415-106691437 GGCCTCAGCCTGATCCCGCTGGG + Intergenic
935971982 2:108538523-108538545 GGACTCAGCATCAGCACACCAGG + Intronic
936410563 2:112254685-112254707 GGGCTCAGGCTTAGGCCGTCAGG - Intronic
936441005 2:112553386-112553408 GGTCTCAGCCTCAACCTCCCAGG + Intronic
937045127 2:118847076-118847098 AGGCTCAGGCTGAGGCCGCCCGG + Exonic
937907984 2:127061625-127061647 GTCCTCAGCCTCAGCCCCTCCGG - Intronic
937975502 2:127579998-127580020 GGACACAGTCTCAGCCCGCAAGG + Intronic
938301065 2:130213547-130213569 GGGCTCAGCCCCAGCCCGCCTGG + Intergenic
938455654 2:131460921-131460943 GGGCTCAGCCCCGGCCCGCCTGG - Intergenic
940954597 2:159713062-159713084 GGGCTCCGGCTCGGCCAGCCCGG + Intronic
942141143 2:172978466-172978488 GTGCTCACCCTCAGTCCTCCTGG + Intronic
943648287 2:190430829-190430851 GGGGTCAGCCCCCGCCCGGCCGG - Intronic
944522540 2:200586564-200586586 TGGCTGAGCCTCAGCTCGCGGGG + Intronic
944688253 2:202136733-202136755 GGCCTGAGCCTCTGCTCGCCGGG - Intronic
946225468 2:218261952-218261974 GGGCTCAGCCTCAGGCCTGGGGG + Intronic
947472461 2:230411973-230411995 GGGCTCCGCCCCCGCCCGGCCGG - Intergenic
947765204 2:232633487-232633509 GGGCTCAGCGACTGCCAGCCTGG - Exonic
947815208 2:233032157-233032179 GGCCTCAGCCTCAGGCAGCCTGG + Intergenic
948473720 2:238203410-238203432 GGGCGCCGCCTCAGCCGCCCCGG + Intronic
948689036 2:239690686-239690708 GGGCCCTGACTCCGCCCGCCCGG - Intergenic
948912300 2:241010741-241010763 GGGCTCACACACAGGCCGCCTGG - Intronic
948989054 2:241542523-241542545 GGACTCACCCTGTGCCCGCCTGG + Intergenic
1169791254 20:9413113-9413135 GGAGTCAGCCTCAGCACTCCTGG + Intronic
1169838537 20:9908017-9908039 GGCCTCAGCCTCATCCCACGGGG + Intergenic
1169894852 20:10492278-10492300 AGGCTCAGCCTCAGCCTCACTGG + Intronic
1170606156 20:17876346-17876368 TGGCTCACTCTGAGCCCGCCTGG + Intergenic
1171189009 20:23145114-23145136 GGGCCTTACCTCAGCCCGCCCGG - Intergenic
1172118214 20:32583910-32583932 GGGCGCCCCCTCAGCCCCCCGGG - Intronic
1172279983 20:33701599-33701621 GGGGTCAGCCCCCGCCCGGCTGG + Intergenic
1172516758 20:35540273-35540295 GGGCTCAACCCCAGCCTCCCAGG + Intergenic
1173029141 20:39338565-39338587 GGGCCCAGCCTGAGCCCAGCAGG + Intergenic
1173658825 20:44719134-44719156 GGGCTCAGCCCCAGCCCTCTGGG - Intronic
1173662278 20:44742931-44742953 TGGCTCAGCCACAGCCTGGCTGG + Intergenic
1174298152 20:49563259-49563281 GGGCTCACCCACAGGCCTCCAGG + Intronic
1174800636 20:53560486-53560508 AGGCTCAACCCCACCCCGCCTGG + Intergenic
1174851491 20:53999668-53999690 GGGCTGAGCTTCTGCCTGCCAGG + Intronic
1175234834 20:57502711-57502733 GGGCCCAGCTTCAGCCAACCTGG + Intronic
1175582619 20:60112365-60112387 GGCCTCAGCTGCAGCCCACCCGG - Intergenic
1175887684 20:62302128-62302150 GGGCTCACCCTCTGGACGCCTGG - Exonic
1176131427 20:63498347-63498369 GGGCTCTGGCCCAGCCTGCCGGG - Intronic
1178334542 21:31731821-31731843 GGGCGCAGCCTCTTCCTGCCCGG - Exonic
1179655472 21:42841938-42841960 GGGCTCAGCCACTGCCCTGCAGG - Intergenic
1179885542 21:44312827-44312849 AGGCTCAGCCTCCTCCTGCCTGG - Intronic
1179985670 21:44919255-44919277 GGGCTCAGCCGCCGCCCTGCAGG + Intronic
1180695638 22:17749996-17750018 GGGCTGAGGCTGAGCCCGCCTGG - Intronic
1180695640 22:17750002-17750024 GGGCTCAGCCTCAGCCCTCAGGG + Intronic
1180931753 22:19596895-19596917 GGGCTCGGCCTGAGCACCCCCGG - Intergenic
1182664887 22:31950740-31950762 GGGCTCAGCCTGACCCTGGCTGG + Intronic
1183697389 22:39430946-39430968 GGCCCCTGCCTCAGCCCACCGGG - Exonic
1184663063 22:45974449-45974471 AGGCTCAGCCCCTGCCCGCCAGG - Intronic
1184686361 22:46098169-46098191 GGGCTCAGCCTGACCCTGACAGG + Intronic
1185241222 22:49748761-49748783 GGGCTCAGCCCCAGCCCCAGAGG + Intergenic
1185241237 22:49748813-49748835 GGGCTCAGCCTCAGCCCCAGAGG + Intergenic
950108144 3:10401279-10401301 GGCCCCAACCTCAGCCCTCCAGG - Intronic
950433647 3:12966252-12966274 AGGCTCAGGCTCAGCGCTCCAGG + Intronic
950570139 3:13794717-13794739 GAACTCATCCTCAGCCCGTCTGG - Intergenic
950667381 3:14505714-14505736 GGGCTGCCCCTCAGCCAGCCAGG + Exonic
954782574 3:53072260-53072282 AGGCTCAGCATCATCCTGCCCGG + Intronic
954878667 3:53819620-53819642 GGGTTCATCCGCAGCCAGCCTGG - Exonic
959591863 3:108090781-108090803 GGGCTGCGCCCCAGCCAGCCCGG - Intronic
960702480 3:120451313-120451335 GGCCACCGCCGCAGCCCGCCCGG - Intergenic
961393675 3:126571335-126571357 GGTCACAGCCTCTGCCCACCTGG + Intergenic
961822110 3:129580490-129580512 GGGCCCAGCCTCTGTCCTCCTGG + Intronic
962245278 3:133785626-133785648 GGGGTCAGCCCCCCCCCGCCCGG + Intronic
962603471 3:137012411-137012433 GGGCTCAGGCTCAGCACTACTGG + Intergenic
968581356 4:1396864-1396886 GCGCTCAGCCACAGCCTCCCAGG + Intergenic
968798986 4:2729684-2729706 TCGCTCAGCCTCTGCCCACCAGG + Intronic
968807647 4:2786256-2786278 GTGCACACCCTCAGCCCTCCTGG - Intergenic
969313179 4:6366271-6366293 GGTCTCAGCCCAGGCCCGCCAGG + Intronic
969445001 4:7239613-7239635 GGGCCCAGCCCCAGCTCCCCAGG - Intronic
969720556 4:8891182-8891204 AGGCACAGCCTCAGCCCCGCAGG + Intergenic
970609188 4:17709603-17709625 GGCCTCAGCCTCATCCTGGCGGG + Exonic
971043335 4:22778738-22778760 GGCCTCAGCCGCCTCCCGCCCGG - Intergenic
972274530 4:37544929-37544951 GGGCACAACCTCTGCCCCCCGGG + Intronic
975690547 4:76958372-76958394 GGCCCCAGCCTCAGCCCTCAGGG + Intronic
985484060 5:139176-139198 GGCCACAGCCACAGCCCACCAGG - Intergenic
985515818 5:344080-344102 GAGCTCAGCCCCGGCCCGCCCGG - Intronic
985561021 5:585816-585838 GGGCGCAGCCTCAGCACCTCTGG - Intergenic
986012184 5:3726151-3726173 GCGCTCAGACAGAGCCCGCCTGG + Intergenic
986337766 5:6767862-6767884 GGGTTAGGCCTCAGCCCGCATGG + Intergenic
986541050 5:8844035-8844057 GGTCTCAGCCTCAGCACGTGTGG - Intergenic
987050420 5:14143594-14143616 GGGCTCTGCGTCCGCGCGCCGGG + Intergenic
987245353 5:16042822-16042844 GGGCTCAGACTGAGCCCTCTAGG - Intergenic
987248977 5:16079645-16079667 GGGCTCAGCCTCCTCTCCCCAGG + Intronic
989523149 5:42424005-42424027 GGGTTCACCCTCAGGCCCCCTGG - Intronic
993022313 5:82605967-82605989 GGGCCCAACCTCAGGCCTCCAGG - Intergenic
995479855 5:112583021-112583043 GGGCTGAGCCACAAACCGCCTGG + Intergenic
997629356 5:135355103-135355125 GGGCTCTGCTTCAGCTAGCCAGG + Intronic
998374584 5:141682272-141682294 GGGCCCAGCCCCGCCCCGCCCGG + Intergenic
999935121 5:156478288-156478310 GAGCTCAGCCTCAGACCTCAAGG + Intronic
1000630191 5:163583670-163583692 GGGGTCAGCCCCCGCCCGGCCGG - Intergenic
1005886656 6:30102364-30102386 GGACGCAGCCTCGGCCCACCCGG - Intergenic
1006027173 6:31154595-31154617 GCCCTCAGCCTCAGCTCGGCCGG + Exonic
1006304929 6:33213218-33213240 GTGCACAGCCTTTGCCCGCCGGG + Intergenic
1006386607 6:33734562-33734584 GGGCTCAGCCACACTCTGCCAGG - Intronic
1006738893 6:36293548-36293570 AGGCACTGCCTCAGACCGCCTGG - Intronic
1007285190 6:40742559-40742581 GGTGCCAGCCTCAGCCCTCCTGG - Intergenic
1007472419 6:42099480-42099502 GGCCTCTGCCTCACCCCTCCAGG + Intergenic
1007599555 6:43073317-43073339 GGACTGAGCCTCGGCCCTCCAGG + Exonic
1008005081 6:46401942-46401964 GAGCTCAGCCTAAGCAGGCCTGG + Intronic
1009724935 6:67526389-67526411 GGGCACAGCCTCAGCTTGCCTGG + Intergenic
1010123963 6:72411643-72411665 AGGCTCAGCCTCAGCCTCCTCGG + Intergenic
1010883996 6:81215042-81215064 GGGCTCAGCCTCAACCCCACCGG - Intergenic
1015905929 6:138116434-138116456 GAGTTCAGCCTCAGCCTCCCTGG + Intergenic
1016034173 6:139368869-139368891 AGGCTCAGCCTCAACCTGCCTGG + Intergenic
1017106880 6:150896343-150896365 GGGCTCATCATCAGCTCTCCAGG + Intronic
1017146592 6:151240621-151240643 GGGCTCGGGCTCAGCCGGCGTGG - Exonic
1017823534 6:158065234-158065256 GGCCTCTCCCTGAGCCCGCCTGG - Intronic
1018134363 6:160765428-160765450 GGGCTCTGTCTCAGCTCTCCTGG + Intergenic
1018150584 6:160933592-160933614 GGGCTCTGTCTCAGCTCTCCTGG - Intergenic
1019122093 6:169811748-169811770 CGGCACAGCCTCATGCCGCCAGG - Intergenic
1019128672 6:169858495-169858517 CAGGTCAGCCTCAGCACGCCAGG - Intergenic
1019216178 6:170445233-170445255 GGGCTCACCCTCCCACCGCCGGG - Intergenic
1019519036 7:1452380-1452402 GGCGTCAGCCTCAGCCCCCAGGG + Intronic
1020016529 7:4834922-4834944 AGGCCCAGCCCCTGCCCGCCCGG - Exonic
1023851046 7:44150683-44150705 GGGCTCAAACTCAGGCAGCCGGG - Intronic
1024059457 7:45687003-45687025 GGGCTCAGCCTCTGCAGGGCTGG + Intronic
1027035595 7:74922862-74922884 GGGCTGAGACTCAGCCTTCCTGG + Intergenic
1029394463 7:100298275-100298297 GGGCTGAGACTCAGCCTTCCTGG - Intergenic
1029571847 7:101375124-101375146 GGACTCAGACTCAGGCAGCCTGG - Intronic
1031943922 7:127818654-127818676 GGGCTCAGCAGCAACCTGCCAGG - Intronic
1034192739 7:149224132-149224154 AGGCTCCGCCGCAGCCCGCCAGG - Exonic
1034494316 7:151410643-151410665 GGGGTCGGCCTGAGCCCTCCCGG + Intronic
1035208937 7:157313542-157313564 TGGCTCAGCCTCAACCTCCCAGG - Intergenic
1035525278 8:307572-307594 GGGCTGAGTCTCAGCCAGCAGGG - Intergenic
1037827829 8:22169848-22169870 GGGCTCAGCCACAGTGCTCCTGG + Intronic
1038176315 8:25184629-25184651 GGCCGCACCCTCCGCCCGCCGGG - Intergenic
1038256412 8:25954970-25954992 GGACTCAGACGCAGCGCGCCAGG + Intronic
1040538522 8:48330575-48330597 GGCCTCAGGCACAGCCCGCAAGG - Intergenic
1040863178 8:52022100-52022122 GGGCTCTGCCTCAGCCTGTCTGG - Intergenic
1042164307 8:65930758-65930780 GGGCACAGACTCAGCCCCCTGGG + Intergenic
1042399774 8:68331572-68331594 GGGCCCAGCCTCAGCCTGGCAGG + Intronic
1043108598 8:76148810-76148832 GGGCTTAGCCTCAGCTCTCTGGG - Intergenic
1047965361 8:130042371-130042393 GGGCTCAGACACACCCCGGCTGG - Intergenic
1049323509 8:142010045-142010067 GGGCTCAGTCTCAGCAGGTCCGG + Intergenic
1049820298 8:144629381-144629403 GTGCTCCGCCTCAGCCCCGCTGG - Intergenic
1052883823 9:33624091-33624113 GAGCTCTGCCTCGGCCTGCCTGG - Intergenic
1056413381 9:86354189-86354211 GGGCTCAGCCTCTGCCGGCCTGG + Intronic
1057390574 9:94639063-94639085 GGGCCCAACGTCAGCCCGCCGGG + Intronic
1057643806 9:96854258-96854280 ACGCTCAGCCTCAGCCGCCCCGG + Exonic
1057786001 9:98087733-98087755 GGCCTCGGCCGCCGCCCGCCTGG - Exonic
1057832903 9:98420283-98420305 TGGCTCAGCCCCAGCCCACCTGG + Intronic
1057890084 9:98863389-98863411 GGGGTCAGCCTGAGCTGGCCTGG - Intergenic
1059150424 9:111944635-111944657 GGTCTGAGCCTCAACCCTCCAGG - Intergenic
1059329113 9:113524048-113524070 GTGGTCAGGCTGAGCCCGCCTGG - Intronic
1059942298 9:119369677-119369699 CGGCTCAGCCCCAGCCCACCCGG - Intergenic
1060520268 9:124290369-124290391 GGGCCCAGCCTCCGCCCCCAAGG + Intronic
1060731491 9:126039697-126039719 AGGCCCAGCCTCAGCTCCCCGGG + Intergenic
1061496489 9:130977792-130977814 GCGCTCAGCCTCACACCTCCGGG - Intergenic
1062584213 9:137241677-137241699 TGACTCAGCCCCGGCCCGCCCGG + Intronic
1062600056 9:137315522-137315544 TGGCTCACCCCCAGCCCTCCTGG - Intronic
1062645710 9:137547162-137547184 GGGCTCAGCCTGAGCCCAGACGG + Intronic
1062653523 9:137590394-137590416 CGGCCCAGCCTCGTCCCGCCCGG - Exonic
1185445334 X:254899-254921 GGGCTGAGCCTGAGCACCCCAGG - Intergenic
1190231554 X:48586243-48586265 GGGCTCAACCTCCGCCTCCCAGG + Intergenic
1192374065 X:70541112-70541134 TAGCTCAGCCTCAGCCCCCCAGG - Intronic
1192585668 X:72316586-72316608 GGGCCCAGCTGCAGCCAGCCAGG + Intergenic
1192630806 X:72776911-72776933 GGGCTAAGCCTCCGCCGCCCGGG - Intergenic
1192650904 X:72943893-72943915 GGGCTAAGCCTCCGCCGCCCGGG + Intergenic
1192795080 X:74420180-74420202 GTGCCCAGCCTCAGCCCTCAGGG - Intergenic
1193423065 X:81308052-81308074 GGGCTCAGTCCCAGTCCCCCAGG - Intergenic
1193793140 X:85841073-85841095 GGGCACATCCTCAGACCTCCAGG - Intergenic
1194364910 X:93003300-93003322 GAGCTCAGCCAGAGCCAGCCGGG + Intergenic
1200242816 X:154506730-154506752 AGCCTCAGCCTCTGTCCGCCCGG + Exonic
1200249509 X:154545247-154545269 GAGCTCTGCCTCACCCCACCTGG - Intronic
1200673138 Y:6119557-6119579 GAGCTCAGCCAGAGCCAGCCGGG + Intergenic
1202095466 Y:21244660-21244682 AGGCTCAGCCTCTGCCTGCTAGG - Intergenic